Transcript: Mouse NM_001130444.1

Mus musculus Harvey rat sarcoma virus oncogene (Hras), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hras (15461)
Length:
2272
CDS:
207..773

Additional Resources:

NCBI RefSeq record:
NM_001130444.1
NBCI Gene record:
Hras (15461)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001130444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366695 GTGAGATTCGGCAGCATAAAT pLKO_005 770 CDS 100% 15.000 21.000 N Hras n/a
2 TRCN0000377024 GAAACTGAACCCACCCGATGA pLKO_005 795 3UTR 100% 4.050 5.670 N Hras n/a
3 TRCN0000377093 TACCGGAAACAGGTGGTCATT pLKO_005 324 CDS 100% 0.000 0.000 N Hras n/a
4 TRCN0000366696 CACGTTGCATCACAGTAAATT pLKO_005 1245 3UTR 100% 15.000 12.000 N Hras n/a
5 TRCN0000034379 GACGAGTATGATCCCACTATA pLKO.1 294 CDS 100% 13.200 10.560 N Hras n/a
6 TRCN0000366694 ACGAGTATGATCCCACTATAG pLKO_005 295 CDS 100% 10.800 8.640 N Hras n/a
7 TRCN0000377025 AGTCAGGTGATATGACCTATT pLKO_005 1483 3UTR 100% 10.800 8.640 N Hras n/a
8 TRCN0000034382 CGGGTGAAAGATTCAGATGAT pLKO.1 510 CDS 100% 4.950 3.465 N Hras n/a
9 TRCN0000034381 CTTCGAGGACATCCATCAGTA pLKO.1 473 CDS 100% 4.950 3.465 N Hras n/a
10 TRCN0000377094 TACTGGACATCTTAGACACAG pLKO_005 361 CDS 100% 4.050 2.835 N Hras n/a
11 TRCN0000034380 CATCAACAACACCAAGTCCTT pLKO.1 455 CDS 100% 2.640 1.848 N Hras n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00784 pDONR223 100% 78.9% 87.3% None (many diffs) n/a
2 ccsbBroad304_00784 pLX_304 0% 78.9% 87.3% V5 (many diffs) n/a
3 TRCN0000479930 CCTCCTTCCTCATTCCATATGCCA pLX_317 64.5% 78.9% 87.3% V5 (many diffs) n/a
4 ccsbBroadEn_16174 pDONR223 0% 74.8% 78.8% None (many diffs) n/a
5 ccsbBroad304_16174 pLX_304 0% 74.8% 78.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489702 TGCTGCGAAAATAACGCGGCGGCC pLX_317 60.1% 73.5% 79.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV