Transcript: Human NM_001130925.2

Homo sapiens endogenous retrovirus group W member 1, envelope (ERVW-1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ERVW-1 (30816)
Length:
2794
CDS:
793..2409

Additional Resources:

NCBI RefSeq record:
NM_001130925.2
NBCI Gene record:
ERVW-1 (30816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062276 CGCCTGGTAAGCCTATTTAAT pLKO.1 1279 CDS 100% 15.000 21.000 N ERVW-1 n/a
2 TRCN0000062273 CCAATCAGAGAGCTCACTAAA pLKO.1 2581 3UTR 100% 13.200 9.240 N ERVW-1 n/a
3 TRCN0000435268 GAATGCAGCGTCCCGGAAATA pLKO_005 911 CDS 100% 13.200 9.240 N ERVW-1 n/a
4 TRCN0000062274 GCACAGAAATAAACACCACTT pLKO.1 1421 CDS 100% 4.050 2.835 N ERVW-1 n/a
5 TRCN0000416680 AGGACCTCTAGCAGCTATAAT pLKO_005 2148 CDS 100% 15.000 9.000 N ERVW-1 n/a
6 TRCN0000427714 ACCTCAGCCTATCGTTGTTTG pLKO_005 1612 CDS 100% 10.800 6.480 N ERVW-1 n/a
7 TRCN0000062277 CCCACACAAATAGTCTGCCTA pLKO.1 1564 CDS 100% 2.640 1.584 N ERVW-1 n/a
8 TRCN0000412806 CACCTTGCAAGATCAACTTAA pLKO_005 1890 CDS 100% 13.200 6.600 Y ERVW-1 n/a
9 TRCN0000062275 CCCTGTATCTTTAACCTCCTT pLKO.1 2188 CDS 100% 2.640 1.320 Y ERVW-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03135 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03135 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476954 TGTGCTCTTCAAGGTTGCAGTGAT pLX_317 18.5% 100% 100% V5 n/a
Download CSV