Transcript: Human NM_001134232.2

Homo sapiens transmembrane protein 106B (TMEM106B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
TMEM106B (54664)
Length:
12351
CDS:
135..959

Additional Resources:

NCBI RefSeq record:
NM_001134232.2
NBCI Gene record:
TMEM106B (54664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123316 CTACCGTTATAGCAGAGGAAA pLKO.1 733 CDS 100% 4.950 6.930 N TMEM106B n/a
2 TRCN0000123318 CCTACCGTTATAGCAGAGGAA pLKO.1 732 CDS 100% 2.640 3.696 N TMEM106B n/a
3 TRCN0000307076 CCTACCGTTATAGCAGAGGAA pLKO_005 732 CDS 100% 2.640 3.696 N TMEM106B n/a
4 TRCN0000123314 CCCATTGTTATATGGTAGTAT pLKO.1 1411 3UTR 100% 5.625 4.500 N TMEM106B n/a
5 TRCN0000129586 CCTGTCCTCATGTCCCATTTA pLKO.1 3029 3UTR 100% 13.200 9.240 N TMEM106B n/a
6 TRCN0000130047 GATGTTCAGAAGCGTACAATT pLKO.1 540 CDS 100% 13.200 9.240 N TMEM106B n/a
7 TRCN0000308162 TATTGGAAAGGCACGCTTAAA pLKO_005 659 CDS 100% 13.200 9.240 N TMEM106B n/a
8 TRCN0000296293 TTCCTAATAGGAGACCTTAAA pLKO_005 1029 3UTR 100% 13.200 9.240 N TMEM106B n/a
9 TRCN0000128488 GATGTCTCTCAGTTTCCATAT pLKO.1 264 CDS 100% 10.800 7.560 N TMEM106B n/a
10 TRCN0000123315 CCATTATTGGTCCACTTGATA pLKO.1 688 CDS 100% 5.625 3.938 N TMEM106B n/a
11 TRCN0000289576 CCATTATTGGTCCACTTGATA pLKO_005 688 CDS 100% 5.625 3.938 N TMEM106B n/a
12 TRCN0000123317 GACGTGAAATACATTGGTGTA pLKO.1 498 CDS 100% 4.050 2.835 N TMEM106B n/a
13 TRCN0000289518 GACGTGAAATACATTGGTGTA pLKO_005 498 CDS 100% 4.050 2.835 N TMEM106B n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6692 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6692 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 11095 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 10286 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 11096 3UTR 100% 13.200 6.600 Y LIAS n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6802 3UTR 100% 4.950 2.475 Y KAAG1 n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6690 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6690 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6690 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 10286 3UTR 100% 4.950 2.475 Y OR11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08399 pDONR223 100% 99.8% 99.6% None 6A>N n/a
2 ccsbBroad304_08399 pLX_304 0% 99.8% 99.6% V5 6A>N n/a
3 TRCN0000470182 AAACACATGCGTTAAATACGACTG pLX_317 34.2% 99.8% 99.6% V5 6A>N n/a
4 ccsbBroadEn_08400 pDONR223 100% 99.7% 99.6% None 372A>G;554C>G n/a
5 ccsbBroad304_08400 pLX_304 0% 99.7% 99.6% V5 372A>G;554C>G n/a
6 TRCN0000469319 ACCCAATCAACCGCACGCAACTTT pLX_317 36.2% 99.7% 99.6% V5 372A>G;554C>G n/a
Download CSV