Transcript: Human NM_001134670.1

Homo sapiens 4-hydroxy-2-oxoglutarate aldolase 1 (HOGA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
HOGA1 (112817)
Length:
2012
CDS:
360..854

Additional Resources:

NCBI RefSeq record:
NM_001134670.1
NBCI Gene record:
HOGA1 (112817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159264 GCTTGTCAGATTGGTAAATAA pLKO.1 1807 3UTR 100% 15.000 21.000 N HOGA1 n/a
2 TRCN0000161117 GCACATGAAGTCAGAAAGGAA pLKO.1 1152 3UTR 100% 3.000 2.400 N HOGA1 n/a
3 TRCN0000160456 CCTGGTGGATAAATGTTACAT pLKO.1 1833 3UTR 100% 5.625 3.938 N HOGA1 n/a
4 TRCN0000166616 CTGGAGGAGAATCTGCACAAA pLKO.1 528 CDS 100% 4.950 3.465 N HOGA1 n/a
5 TRCN0000166357 CTATGGGAAACTGGAGGAGAA pLKO.1 518 CDS 100% 4.050 2.835 N HOGA1 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1452 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1452 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134670.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16074 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16074 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492014 TTCCAAACCCATTACCTTCAACGA pLX_317 67.1% 100% 100% V5 n/a
4 ccsbBroadEn_09380 pDONR223 100% 50% 50.1% None 210_211ins489;423C>A n/a
5 ccsbBroad304_09380 pLX_304 0% 50% 50.1% V5 210_211ins489;423C>A n/a
6 TRCN0000473037 CGAATACGAGCAAAGGAGGGCTTC pLX_317 47.3% 50% 50.1% V5 210_211ins489;423C>A n/a
Download CSV