Transcript: Human NM_001136200.2

Homo sapiens BLOC-1 related complex subunit 7 (BORCS7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
BORCS7 (119032)
Length:
2386
CDS:
29..349

Additional Resources:

NCBI RefSeq record:
NM_001136200.2
NBCI Gene record:
BORCS7 (119032)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128988 GCATGACGTTACTGCCAAATA pLKO.1 1350 3UTR 100% 13.200 18.480 N BORCS7 n/a
2 TRCN0000431755 AGTAACAGTGAATCCAATATA pLKO_005 1622 3UTR 100% 15.000 10.500 N BORCS7 n/a
3 TRCN0000423627 GTCTGTTGTCAAACCTAAATA pLKO_005 1483 3UTR 100% 15.000 10.500 N BORCS7 n/a
4 TRCN0000434285 ATTAGGCAAGTGGTATCATTA pLKO_005 1207 3UTR 100% 13.200 9.240 N BORCS7 n/a
5 TRCN0000130339 GCCAAATATGAAGGCAGTTGA pLKO.1 1363 3UTR 100% 4.950 3.465 N BORCS7 n/a
6 TRCN0000129011 GATCTACAGGACCAGTTGAAT pLKO.1 314 CDS 100% 5.625 2.813 Y BORCS7 n/a
7 TRCN0000129805 CCAGTTGAATCATCTGTTGAA pLKO.1 325 CDS 100% 4.950 2.475 Y BORCS7 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 498 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000128243 GCAAGAAGCTATTCAGAAGAA pLKO.1 277 CDS 100% 4.950 2.475 Y BORCS7 n/a
10 TRCN0000129528 GCCATCTTGCACTCAGAAGAT pLKO.1 212 CDS 100% 0.495 0.248 Y BORCS7 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 499 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000182442 GCAGCTCGAAACATGGTACTA pLKO.1 182 CDS 100% 4.950 2.475 Y Borcs7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13073 pDONR223 100% 99% 99% None 1_3delATG n/a
2 ccsbBroad304_13073 pLX_304 0% 99% 99% V5 1_3delATG n/a
3 TRCN0000466605 GGGCATGATAGTAGCACCACATAC pLX_317 100% 99% 99% V5 1_3delATG n/a
Download CSV