Transcript: Human NM_001139468.1

Homo sapiens transducin beta like 1 X-linked (TBL1X), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TBL1X (6907)
Length:
5586
CDS:
512..2092

Additional Resources:

NCBI RefSeq record:
NM_001139468.1
NBCI Gene record:
TBL1X (6907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001139468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118647 GCGTAGTAAGTGCTTTATGTA pLKO.1 3000 3UTR 100% 5.625 7.875 N TBL1X n/a
2 TRCN0000310425 GCGTAGTAAGTGCTTTATGTA pLKO_005 3000 3UTR 100% 5.625 7.875 N TBL1X n/a
3 TRCN0000118651 GAATACCAATGGAACACTCTT pLKO.1 1246 CDS 100% 4.950 3.960 N TBL1X n/a
4 TRCN0000299581 GAATACCAATGGAACACTCTT pLKO_005 1246 CDS 100% 4.950 3.960 N TBL1X n/a
5 TRCN0000303716 ATGATCTTCAGGCTCACAATA pLKO_005 1701 CDS 100% 13.200 9.240 N TBL1X n/a
6 TRCN0000118649 CTTCGACAAGTGCGTCCATAT pLKO.1 1930 CDS 100% 10.800 7.560 N TBL1X n/a
7 TRCN0000299525 CTTCGACAAGTGCGTCCATAT pLKO_005 1930 CDS 100% 10.800 7.560 N TBL1X n/a
8 TRCN0000118650 GAGATCAGTATCAACGAGGAT pLKO.1 698 CDS 100% 2.640 1.848 N TBL1X n/a
9 TRCN0000299582 GAGATCAGTATCAACGAGGAT pLKO_005 698 CDS 100% 2.640 1.848 N TBL1X n/a
10 TRCN0000153227 GAGACTCAACTGCAAGGATAT pLKO.1 1113 CDS 100% 10.800 5.400 Y TBL1Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001139468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04526 pDONR223 100% 90.4% 90.6% None (many diffs) n/a
2 ccsbBroad304_04526 pLX_304 0% 90.4% 90.6% V5 (many diffs) n/a
3 TRCN0000466084 ACACCCCAAGATTCCCCTAAGATG pLX_317 20.9% 90.4% 90.6% V5 (many diffs) n/a
Download CSV