Transcript: Human NM_001142325.1

Homo sapiens solute carrier family 18 member A1 (SLC18A1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SLC18A1 (6570)
Length:
2840
CDS:
472..1890

Additional Resources:

NCBI RefSeq record:
NM_001142325.1
NBCI Gene record:
SLC18A1 (6570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044753 GCGTACCTAGTGGAATAGCAT pLKO.1 755 CDS 100% 3.000 4.200 N SLC18A1 n/a
2 TRCN0000044755 GCTGGCTTTGTTATCATGTTT pLKO.1 985 CDS 100% 5.625 4.500 N SLC18A1 n/a
3 TRCN0000426461 ATAGAGGTGGTAGTGAGTAAT pLKO_005 2222 3UTR 100% 13.200 9.240 N SLC18A1 n/a
4 TRCN0000418688 GAAGTGTAATGTACGAGTTTG pLKO_005 1211 CDS 100% 10.800 7.560 N SLC18A1 n/a
5 TRCN0000044756 CCATAGGCATGGTGGATTCTT pLKO.1 1676 CDS 100% 5.625 3.938 N SLC18A1 n/a
6 TRCN0000044757 CTTCCTATATGACATGGAGTT pLKO.1 612 CDS 100% 4.050 2.430 N SLC18A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06969 pDONR223 100% 83.6% 75.5% None (many diffs) n/a
2 ccsbBroad304_06969 pLX_304 0% 83.6% 75.5% V5 (many diffs) n/a
3 TRCN0000474358 TGTGTGTGCCGCGTCATACAACGA pLX_317 36.3% 83.6% 75.5% V5 (many diffs) n/a
4 ccsbBroadEn_11140 pDONR223 100% 81% 81.1% None (many diffs) n/a
5 ccsbBroad304_11140 pLX_304 0% 81% 81.1% V5 (many diffs) n/a
6 TRCN0000480683 GTGTACTAACCACTCCTTAGATGA pLX_317 36.4% 81% 81.1% V5 (many diffs) n/a
Download CSV