Transcript: Human NM_001142344.2

Homo sapiens chemerin chemokine-like receptor 1 (CMKLR1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
CMKLR1 (1240)
Length:
5275
CDS:
359..1480

Additional Resources:

NCBI RefSeq record:
NM_001142344.2
NBCI Gene record:
CMKLR1 (1240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367733 TCGCCTGGTCAATGCTCTAAG pLKO_005 1354 CDS 100% 10.800 15.120 N CMKLR1 n/a
2 TRCN0000011275 CCCTGATTATTTAGACTCCAT pLKO.1 412 CDS 100% 2.640 3.696 N CMKLR1 n/a
3 TRCN0000011278 CTTCAAGATTATTGTGACCAT pLKO.1 1132 CDS 100% 2.640 3.696 N CMKLR1 n/a
4 TRCN0000356843 AGCCTTGGACTAGCAATTTAT pLKO_005 1680 3UTR 100% 15.000 12.000 N CMKLR1 n/a
5 TRCN0000011274 CCTCTTTAGCATCCACCAATT pLKO.1 1561 3UTR 100% 10.800 8.640 N CMKLR1 n/a
6 TRCN0000356909 TGATGAATACCCTGATTATTT pLKO_005 403 CDS 100% 15.000 10.500 N CMKLR1 n/a
7 TRCN0000356844 ATCACACTTGGCCCTTGTATA pLKO_005 1894 3UTR 100% 13.200 9.240 N CMKLR1 n/a
8 TRCN0000011276 GCTTTACCAAGATGTCATCAA pLKO.1 1413 CDS 100% 4.950 3.465 N CMKLR1 n/a
9 TRCN0000011277 CCTGGCTTACATGGCCTGCAT pLKO.1 820 CDS 100% 0.880 0.616 N CMKLR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00335 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00335 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480389 TCCGAGGTGCGGGTCTGAATCAAA pLX_317 37.6% 100% 100% V5 n/a
4 TRCN0000488274 ATCCATAGAACGATGCTTCAATTC pLX_317 28.9% 99.4% 99.4% V5 (not translated due to prior stop codon) 1_6delATGAGA n/a
5 TRCN0000488290 CTGTGACTAATGTACAGGAGTAAC pLX_317 20% 99.3% 99.1% V5 1_6delATGAGA;1119_1120insG n/a
Download CSV