Transcript: Human NM_001142414.1

Homo sapiens CGRP receptor component (CRCP), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CRCP (27297)
Length:
2648
CDS:
12..437

Additional Resources:

NCBI RefSeq record:
NM_001142414.1
NBCI Gene record:
CRCP (27297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304008 TGGTGGGCCATGTCCTAATTA pLKO_005 771 3UTR 100% 15.000 12.000 N CRCP n/a
2 TRCN0000304009 CGAAGAGGACCCAGCATAGAA pLKO_005 419 CDS 100% 5.625 3.938 N CRCP n/a
3 TRCN0000061416 GAAGAAGAATACAAACAGCAA pLKO.1 386 CDS 100% 2.640 1.848 N CRCP n/a
4 TRCN0000304072 AGGCACCAGAGTCCTGAAATT pLKO_005 165 CDS 100% 13.200 7.920 N CRCP n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1878 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1878 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000061415 CAGAGAATTTCTCACAGCATT pLKO.1 188 CDS 100% 4.950 2.475 Y CRCP n/a
8 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1876 3UTR 100% 4.950 2.475 Y ERN2 n/a
9 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1876 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1876 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1423 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142414.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03023 pDONR223 100% 81.3% 80.8% None 1_78delinsA;81delT n/a
2 ccsbBroad304_03023 pLX_304 0% 81.3% 80.8% V5 1_78delinsA;81delT n/a
3 TRCN0000466312 GGGAGGACGGGTCATTGCGTAGCG pLX_317 60% 81.3% 80.8% V5 1_78delinsA;81delT n/a
4 TRCN0000488724 AAGTTCTTCTTGTCAAACGAACTG pLX_317 82% 65.9% 65.5% V5 1_78delinsA;81delT;123_124ins99 n/a
Download CSV