Transcript: Human NM_001142428.1

Homo sapiens mortality factor 4 like 2 (MORF4L2), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
MORF4L2 (9643)
Length:
1978
CDS:
436..1302

Additional Resources:

NCBI RefSeq record:
NM_001142428.1
NBCI Gene record:
MORF4L2 (9643)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107307 GCACCACACCTACTGAGATTA pLKO.1 1108 CDS 100% 13.200 18.480 N MORF4L2 n/a
2 TRCN0000095666 CGCAGGGAAATGTTGATAATA pLKO.1 938 CDS 100% 15.000 10.500 N Morf4l2 n/a
3 TRCN0000332779 CGCAGGGAAATGTTGATAATA pLKO_005 938 CDS 100% 15.000 10.500 N Morf4l2 n/a
4 TRCN0000434448 TCTGGAGGAGTATGCAAATTG pLKO_005 909 CDS 100% 13.200 9.240 N MORF4L2 n/a
5 TRCN0000422729 TTACTGCCAGTGATTACAAAG pLKO_005 1247 CDS 100% 10.800 7.560 N MORF4L2 n/a
6 TRCN0000107309 GACCAGAAAGAACAAGCAGAA pLKO.1 657 CDS 100% 4.050 2.835 N MORF4L2 n/a
7 TRCN0000107305 GCATTCTATCTTTGCTCAAAT pLKO.1 1776 3UTR 100% 13.200 7.920 N MORF4L2 n/a
8 TRCN0000107308 TGTTGGGCTATTTGCATGATT pLKO.1 1190 CDS 100% 5.625 3.375 N MORF4L2 n/a
9 TRCN0000107306 CTTGCATTATTGTTGGGCTAT pLKO.1 1180 CDS 100% 4.050 2.430 N MORF4L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02219 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02219 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473386 TACGACTGAGGTCCGCGTAAGGTC pLX_317 65.6% 100% 100% V5 n/a
4 ccsbBroadEn_14059 pDONR223 100% 68.2% 70.8% None (many diffs) n/a
5 ccsbBroad304_14059 pLX_304 0% 68.2% 70.8% V5 (many diffs) n/a
6 ccsbBroadEn_15732 pDONR223 0% 68.2% 70.8% None (many diffs) n/a
7 ccsbBroad304_15732 pLX_304 0% 68.2% 70.8% V5 (many diffs) n/a
8 TRCN0000472961 ACCCGGTGTCATGCCACGCTAAAA pLX_317 76.3% 68.2% 70.8% V5 (many diffs) n/a
Download CSV