Transcript: Human NM_001142475.2

Homo sapiens neuronal regeneration related protein (NREP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
NREP (9315)
Length:
2651
CDS:
194..532

Additional Resources:

NCBI RefSeq record:
NM_001142475.2
NBCI Gene record:
NREP (9315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322722 TAATCGTAACACCTCCATTTG pLKO_005 530 CDS 100% 10.800 15.120 N NREP n/a
2 TRCN0000136334 GCCTGAGTTTCTTGTGCATTA pLKO.1 1907 3UTR 100% 10.800 7.560 N NREP n/a
3 TRCN0000322778 GCCTGAGTTTCTTGTGCATTA pLKO_005 1907 3UTR 100% 10.800 7.560 N NREP n/a
4 TRCN0000134967 CCCAACGAAATGGATAAACAA pLKO.1 1695 3UTR 100% 5.625 3.938 N NREP n/a
5 TRCN0000134039 CAAGAACCATTTCCAAACAAG pLKO.1 362 CDS 100% 4.950 3.465 N NREP n/a
6 TRCN0000133785 CAAGAAGAACGATGAGACAAA pLKO.1 439 CDS 100% 4.950 3.465 N NREP n/a
7 TRCN0000135903 GCAAGAAGAACGATGAGACAA pLKO.1 438 CDS 100% 4.950 3.465 N NREP n/a
8 TRCN0000370233 ACCATTTCCAAACAAGGACAT pLKO_005 367 CDS 100% 4.050 2.835 N NREP n/a
9 TRCN0000322721 CCGCAAGAAGAACGATGAGAC pLKO_005 436 CDS 100% 4.050 2.835 N NREP n/a
10 TRCN0000370232 CCTGTCCCAAAGGAAGTGAAC pLKO_005 416 CDS 100% 4.050 2.835 N NREP n/a
11 TRCN0000370231 CAAGAATCAGTTACCTCCACT pLKO_005 504 CDS 100% 2.640 1.848 N NREP n/a
12 TRCN0000322779 TCCTAAGGGAAGACTTCCTGT pLKO_005 400 CDS 100% 2.640 1.848 N NREP n/a
13 TRCN0000135745 CCATTTCCAAACAAGGACATG pLKO.1 368 CDS 100% 4.050 2.430 N NREP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02134 pDONR223 100% 60.4% 59.8% None 1_132delinsA;135delT n/a
2 ccsbBroad304_02134 pLX_304 0% 60.4% 59.8% V5 1_132delinsA;135delT n/a
3 TRCN0000470347 GATTTCGACCCTGGACTCATTCAA pLX_317 100% 60.4% 59.8% V5 1_132delinsA;135delT n/a
Download CSV