Transcript: Mouse NM_001142570.1

Mus musculus dachshund 2 (Drosophila) (Dach2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dach2 (93837)
Length:
5991
CDS:
172..1992

Additional Resources:

NCBI RefSeq record:
NM_001142570.1
NBCI Gene record:
Dach2 (93837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108579 GATAAGATACAATCTCCACTT pLKO.1 952 CDS 100% 4.050 3.240 N Dach2 n/a
2 TRCN0000423706 AGCTGAAGAGACTCGACATAT pLKO_005 527 CDS 100% 13.200 9.240 N Dach2 n/a
3 TRCN0000415375 AGACTCTGTTGACCAACATTC pLKO_005 1604 CDS 100% 10.800 7.560 N DACH2 n/a
4 TRCN0000108578 CCTCGCAGATGGATCATCATT pLKO.1 1361 CDS 100% 5.625 3.938 N Dach2 n/a
5 TRCN0000108576 CCAACAATCGAGAAGAGCTTA pLKO.1 1403 CDS 100% 4.950 3.465 N Dach2 n/a
6 TRCN0000108577 CCCTAACATGATCAACAGTTT pLKO.1 288 CDS 100% 4.950 3.465 N Dach2 n/a
7 TRCN0000020811 CCATTTATGATGATGCCTCAT pLKO.1 1096 CDS 100% 4.050 2.835 N DACH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13061 pDONR223 100% 63.3% 63.2% None (many diffs) n/a
2 ccsbBroad304_13061 pLX_304 0% 63.3% 63.2% V5 (many diffs) n/a
3 TRCN0000473331 TGCTGATAAACTCCCGCTAAAGCA pLX_317 35.9% 63.3% 63.2% V5 (many diffs) n/a
Download CSV