Transcript: Human NM_001142805.2

Homo sapiens solute carrier family 6 member 8 (SLC6A8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC6A8 (6535)
Length:
3901
CDS:
650..2527

Additional Resources:

NCBI RefSeq record:
NM_001142805.2
NBCI Gene record:
SLC6A8 (6535)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365223 GCACCATGAGTGCTCACTAAA pLKO_005 2658 3UTR 100% 13.200 9.240 N SLC6A8 n/a
2 TRCN0000365225 CTTATTCCCTACGTCCTGATC pLKO_005 920 CDS 100% 4.050 2.835 N SLC6A8 n/a
3 TRCN0000365224 CAGCAGAACCAAGGCAAATAT pLKO_005 2988 3UTR 100% 15.000 9.000 N SLC6A8 n/a
4 TRCN0000377545 ACCGCTTCATGGACGACATTG pLKO_005 2121 CDS 100% 10.800 6.480 N SLC6A8 n/a
5 TRCN0000042854 CACGGGAAAGATCGTGTACTT pLKO.1 1417 CDS 100% 4.950 2.970 N SLC6A8 n/a
6 TRCN0000042853 CCTACTACTTCCGTTTCCAAA pLKO.1 1926 CDS 100% 4.950 2.970 N SLC6A8 n/a
7 TRCN0000079862 CTACAACAACACCTACGTGTA pLKO.1 2257 CDS 100% 4.050 2.430 N Slc6a8 n/a
8 TRCN0000332079 CTACAACAACACCTACGTGTA pLKO_005 2257 CDS 100% 4.050 2.430 N Slc6a8 n/a
9 TRCN0000370409 ATTACCTGGTCAAGTCCTTTA pLKO_005 1119 CDS 100% 10.800 5.400 Y SLC6A8 n/a
10 TRCN0000377577 CTCAAGCCTGACTGGTCAAAG pLKO_005 1526 CDS 100% 10.800 5.400 Y SLC6A8 n/a
11 TRCN0000079859 CGTGTACTTCACTGCTACATT pLKO.1 1429 CDS 100% 5.625 2.813 Y Slc6a8 n/a
12 TRCN0000332016 CGTGTACTTCACTGCTACATT pLKO_005 1429 CDS 100% 5.625 2.813 Y Slc6a8 n/a
13 TRCN0000043474 CATGGGCATCTTCATCTTCAA pLKO.1 2212 CDS 100% 4.950 2.475 Y SLC6A10P n/a
14 TRCN0000042856 CCTGTTCTTCTTCATGCTGTT pLKO.1 1831 CDS 100% 4.050 2.025 Y SLC6A8 n/a
15 TRCN0000079861 GCAGCATCAATGTCTGGAACA pLKO.1 1005 CDS 100% 4.050 2.025 Y Slc6a8 n/a
16 TRCN0000332078 GCAGCATCAATGTCTGGAACA pLKO_005 1005 CDS 100% 4.050 2.025 Y Slc6a8 n/a
17 TRCN0000043477 GATGAAATGGTGCTGGTCCTT pLKO.1 2173 CDS 100% 2.640 1.320 Y SLC6A10P n/a
18 TRCN0000042857 GCTGGTCTACAACAACACCTA pLKO.1 2251 CDS 100% 2.640 1.320 Y SLC6A8 n/a
19 TRCN0000043476 CATTGCCTGTATGATCGGGTA pLKO.1 2137 CDS 100% 2.160 1.080 Y SLC6A10P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142805.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.