Transcript: Mouse NM_001142952.1

Mus musculus family with sequence similarity 46, member C (Fam46c), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam46c (74645)
Length:
2054
CDS:
127..1302

Additional Resources:

NCBI RefSeq record:
NM_001142952.1
NBCI Gene record:
Fam46c (74645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268032 CATTGCGCACCCTCCAATTAC pLKO_005 1242 CDS 100% 13.200 18.480 N Fam46c n/a
2 TRCN0000268075 AGTACGACTACCTCATGATTC pLKO_005 1034 CDS 100% 10.800 15.120 N Fam46c n/a
3 TRCN0000434135 ACTTTCCAACCTTGGAGATAA pLKO_005 245 CDS 100% 13.200 9.240 N TENT5C n/a
4 TRCN0000268031 TTCTGCCAGAGGGCGTGAATA pLKO_005 482 CDS 100% 13.200 9.240 N Fam46c n/a
5 TRCN0000268030 AGCTGAGTTCTCGGTAGATTC pLKO_005 1661 3UTR 100% 10.800 7.560 N Fam46c n/a
6 TRCN0000283586 CAATCCCATCTCCGAGCATTT pLKO_005 723 CDS 100% 10.800 7.560 N Fam46c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142952.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15873 pDONR223 0% 89.9% 95.9% None (many diffs) n/a
2 ccsbBroad304_15873 pLX_304 0% 89.9% 95.9% V5 (many diffs) n/a
3 TRCN0000480531 GACTCCGATGACCGGCAACATGAA pLX_317 30.2% 89.9% 95.9% V5 (many diffs) n/a
4 ccsbBroadEn_08421 pDONR223 100% 89.9% 95.9% None (many diffs) n/a
5 ccsbBroad304_08421 pLX_304 0% 89.9% 95.9% V5 (many diffs) n/a
Download CSV