Transcript: Human NM_001143886.1

Homo sapiens protein phosphatase 1 regulatory subunit 12A (PPP1R12A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PPP1R12A (4659)
Length:
5337
CDS:
140..2971

Additional Resources:

NCBI RefSeq record:
NM_001143886.1
NBCI Gene record:
PPP1R12A (4659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231492 GGCTAAATAGTGGTCATATAA pLKO_005 429 CDS 100% 15.000 21.000 N PPP1R12A n/a
2 TRCN0000356389 TGAAGGATCAACGTATCATAA pLKO_005 1510 CDS 100% 13.200 10.560 N PPP1R12A n/a
3 TRCN0000231496 GTAACCCAGTGGACCATAATT pLKO_005 3011 3UTR 100% 15.000 10.500 N PPP1R12A n/a
4 TRCN0000231494 ATGAGACTTACCAGCGTTATA pLKO_005 2166 CDS 100% 13.200 9.240 N PPP1R12A n/a
5 TRCN0000356387 CAACACCTACATCACCTATTA pLKO_005 1092 CDS 100% 13.200 9.240 N PPP1R12A n/a
6 TRCN0000231495 GTATGCTTCAAGTCAACTAAA pLKO_005 2251 CDS 100% 13.200 9.240 N PPP1R12A n/a
7 TRCN0000231493 TTGCGAACAAGTAGTTCATAT pLKO_005 1442 CDS 100% 13.200 9.240 N PPP1R12A n/a
8 TRCN0000356314 TTTACAGCTCCAGCATATAAG pLKO_005 3252 3UTR 100% 13.200 9.240 N PPP1R12A n/a
9 TRCN0000002443 GCACTACTACAAAGATTACAA pLKO.1 1650 CDS 100% 5.625 3.938 N PPP1R12A n/a
10 TRCN0000002447 CCAGAACGTATGATGAGACTT pLKO.1 2154 CDS 100% 4.950 3.465 N PPP1R12A n/a
11 TRCN0000002444 CCAGCATATAAGGAAAGTGTT pLKO.1 3261 3UTR 100% 4.950 3.465 N PPP1R12A n/a
12 TRCN0000002445 GCCTTTGATGTAGCAGATGAA pLKO.1 680 CDS 100% 4.950 3.465 N PPP1R12A n/a
13 TRCN0000356315 ATGGAACTAACAGATCTTAAA pLKO_005 2741 CDS 100% 13.200 7.920 N PPP1R12A n/a
14 TRCN0000002446 GCAGCTCGAAAGGAAGAAGAA pLKO.1 380 CDS 100% 4.950 2.970 N PPP1R12A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06613 pDONR223 100% 91.5% 91.5% None 0_1ins261 n/a
2 ccsbBroad304_06613 pLX_304 0% 91.5% 91.5% V5 0_1ins261 n/a
3 TRCN0000472541 ATCGCGCAGATCGTGGAATATTAG pLX_317 15.7% 91.5% 91.5% V5 0_1ins261 n/a
Download CSV