Transcript: Human NM_001143938.3

Homo sapiens zinc finger protein 534 (ZNF534), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
ZNF534 (147658)
Length:
5203
CDS:
165..2150

Additional Resources:

NCBI RefSeq record:
NM_001143938.3
NBCI Gene record:
ZNF534 (147658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219829 GCGAGATCTTTAGTAGCAATT pLKO.1 823 CDS 100% 10.800 15.120 N ZNF534 n/a
2 TRCN0000219832 CTTGCGCGACATAGGAATATT pLKO.1 1857 CDS 100% 15.000 19.500 N ZNF534 n/a
3 TRCN0000219831 CTTGCACAACATAGGGATATT pLKO.1 1689 CDS 100% 13.200 10.560 N ZNF534 n/a
4 TRCN0000219830 TTCACGCCTTGCACGACATAG pLKO.1 1346 CDS 100% 10.800 6.480 N ZNF534 n/a
5 TRCN0000164103 CAGGGACGTGATGTTAGAGAA pLKO.1 263 CDS 100% 4.950 2.970 N ZNF534 n/a
6 TRCN0000159017 GATGTTAGAGAACTACAGGAA pLKO.1 272 CDS 100% 2.640 1.584 N ZNF534 n/a
7 TRCN0000161881 GCAGAAAGCTTTATACAGGGA pLKO.1 248 CDS 100% 0.660 0.396 N ZNF534 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3222 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 2240 3UTR 100% 4.050 2.025 Y LOC441087 n/a
10 TRCN0000151709 CAAATGTAATGAGTGTGGCAA pLKO.1 1310 CDS 100% 2.640 1.320 Y ZNF320 n/a
11 TRCN0000162896 GAATCTGTCTTCCTGACCTGA pLKO.1 307 CDS 100% 2.640 1.320 Y ZNF534 n/a
12 TRCN0000239545 CCTTACAAATGTAGTGAATTT pLKO_005 1053 CDS 100% 13.200 6.600 Y Gm13212 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3223 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2675 3UTR 100% 10.800 5.400 Y SMIM11A n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3865 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1126 CDS 100% 5.625 2.813 Y ZNF345 n/a
17 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1651 CDS 100% 4.950 2.475 Y ZNF813 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3865 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143938.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.