Transcript: Human NM_001143970.1

Homo sapiens chromodomain Y like (CDYL), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CDYL (9425)
Length:
3326
CDS:
584..1822

Additional Resources:

NCBI RefSeq record:
NM_001143970.1
NBCI Gene record:
CDYL (9425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379529 GATGGCTGTTCTACCGTTATG pLKO_005 1472 CDS 100% 10.800 15.120 N CDYL n/a
2 TRCN0000127490 CCTAGCGAAGTCAGGTATCAA pLKO.1 589 CDS 100% 5.625 7.875 N CDYL n/a
3 TRCN0000276374 CCTAGCGAAGTCAGGTATCAA pLKO_005 589 CDS 100% 5.625 7.875 N CDYL n/a
4 TRCN0000130348 GCCCATTATTGTAGCAGTCAA pLKO.1 1342 CDS 100% 4.950 6.930 N CDYL n/a
5 TRCN0000285539 GCCCATTATTGTAGCAGTCAA pLKO_005 1342 CDS 100% 4.950 6.930 N CDYL n/a
6 TRCN0000380052 GCGATGTGGTTTGGGCTAATG pLKO_005 1404 CDS 100% 10.800 8.640 N CDYL n/a
7 TRCN0000380240 CTATCAGAAACTTCGTGAATA pLKO_005 1302 CDS 100% 13.200 9.240 N CDYL n/a
8 TRCN0000276335 GAAGTGATGGTTCGCATTAAG pLKO_005 1619 CDS 100% 13.200 9.240 N CDYL n/a
9 TRCN0000130319 GCTGGGTGAGAAATACTACTT pLKO.1 2656 3UTR 100% 4.950 3.465 N CDYL n/a
10 TRCN0000129081 GCTTAGGATTCATGCTGAGAT pLKO.1 2423 3UTR 100% 4.950 3.465 N CDYL n/a
11 TRCN0000276336 GCTTAGGATTCATGCTGAGAT pLKO_005 2423 3UTR 100% 4.950 3.465 N CDYL n/a
12 TRCN0000126138 GCTTGGTTTCAAACACCCTAT pLKO.1 1430 CDS 100% 4.050 2.835 N Cdyl n/a
13 TRCN0000308353 GCTTGGTTTCAAACACCCTAT pLKO_005 1430 CDS 100% 4.050 2.835 N Cdyl n/a
14 TRCN0000126135 CCGTTATGTTTCCCAAGATTA pLKO.1 1485 CDS 100% 13.200 9.240 N Cdyl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11367 pDONR223 100% 74.8% 74.5% None 1_309del;1193T>C;1213T>A n/a
2 ccsbBroad304_11367 pLX_304 0% 74.8% 74.5% V5 1_309del;1193T>C;1213T>A n/a
3 TRCN0000481143 ATAAGGACCTCTTAAGTGCTCTAA pLX_317 44.9% 74.8% 74.5% V5 1_309del;1193T>C;1213T>A n/a
Download CSV