Transcript: Human NM_001144903.3

Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TM6SF1 (53346)
Length:
1792
CDS:
37..1056

Additional Resources:

NCBI RefSeq record:
NM_001144903.3
NBCI Gene record:
TM6SF1 (53346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423689 GAAGTATGGAACACGAATTTG pLKO_005 519 CDS 100% 13.200 18.480 N TM6SF1 n/a
2 TRCN0000138288 CCGTATCTGAACACCGCATAT pLKO.1 337 CDS 100% 10.800 15.120 N TM6SF1 n/a
3 TRCN0000421121 CACTGTATGTGTGAGCTATAT pLKO_005 1180 3UTR 100% 13.200 9.240 N TM6SF1 n/a
4 TRCN0000133980 CCATTTCACTCTCTTCTCATA pLKO.1 1124 3UTR 100% 4.950 3.465 N TM6SF1 n/a
5 TRCN0000134931 CCCTCAAAGGTTATTCAAGAA pLKO.1 631 CDS 100% 4.950 3.465 N TM6SF1 n/a
6 TRCN0000135885 GCTCTGCTCATTATCTGATGT pLKO.1 383 CDS 100% 4.950 3.465 N TM6SF1 n/a
7 TRCN0000137625 GCTTAGTGGTTCCTGGATGTT pLKO.1 797 CDS 100% 4.950 3.465 N TM6SF1 n/a
8 TRCN0000135809 CCACTGTTCTATGTGTATGCA pLKO.1 220 CDS 100% 3.000 2.100 N TM6SF1 n/a
9 TRCN0000137796 GAACACGAATTTGCCCTGCTT pLKO.1 527 CDS 100% 2.640 1.848 N TM6SF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144903.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12020 pDONR223 100% 55.4% 49.1% None 481_707del;792_1017del n/a
2 ccsbBroad304_12020 pLX_304 0% 55.4% 49.1% V5 481_707del;792_1017del n/a
3 TRCN0000480894 TTGCCTACGGTTGCTGGAAAACCC pLX_317 62.5% 55.4% 49.1% V5 481_707del;792_1017del n/a
4 ccsbBroadEn_14157 pDONR223 100% 41.9% 2.6% None (many diffs) n/a
5 ccsbBroad304_14157 pLX_304 0% 41.9% 2.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000472759 ACGGCCTATTAGACCTGAAACGTC pLX_317 100% 41.9% 2.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV