Transcript: Mouse NM_001145877.2

Mus musculus solute carrier family 25, member 44 (Slc25a44), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Slc25a44 (229517)
Length:
3456
CDS:
371..1057

Additional Resources:

NCBI RefSeq record:
NM_001145877.2
NBCI Gene record:
Slc25a44 (229517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127997 GCCAGAGTAACACAGTCAAAT pLKO.1 741 CDS 100% 13.200 9.240 N SLC25A44 n/a
2 TRCN0000276297 GCCAGAGTAACACAGTCAAAT pLKO_005 741 CDS 100% 13.200 9.240 N SLC25A44 n/a
3 TRCN0000129598 CAGCCAGAGTAACACAGTCAA pLKO.1 739 CDS 100% 4.950 3.465 N SLC25A44 n/a
4 TRCN0000125149 GCTTTCACTATCAAGACCTTT pLKO.1 2936 3UTR 100% 4.950 3.465 N Slc25a44 n/a
5 TRCN0000125152 GCCAGTGCTATGTCACCACTT pLKO.1 687 CDS 100% 4.050 2.835 N Slc25a44 n/a
6 TRCN0000125150 GCTGCTAACGTACATCCCAAA pLKO.1 994 CDS 100% 4.050 2.835 N Slc25a44 n/a
7 TRCN0000125153 CCCTTCTACCACTTCTATGCA pLKO.1 1031 CDS 100% 3.000 2.100 N Slc25a44 n/a
8 TRCN0000125151 CAAGAAGAAGTTCTATGTGTT pLKO.1 475 CDS 100% 4.950 2.970 N Slc25a44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145877.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02224 pDONR223 100% 55.9% 60.3% None (many diffs) n/a
2 ccsbBroad304_02224 pLX_304 0% 55.9% 60.3% V5 (many diffs) n/a
3 TRCN0000466930 TCTTGAACCTCGAGATTATGACTC pLX_317 45% 55.9% 60.3% V5 (many diffs) n/a
Download CSV