Transcript: Human NM_001146099.1

Homo sapiens NIMA related kinase 3 (NEK3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
NEK3 (4752)
Length:
2345
CDS:
377..1846

Additional Resources:

NCBI RefSeq record:
NM_001146099.1
NBCI Gene record:
NEK3 (4752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194949 CTAATATTGTTGCCTTCAAAG pLKO.1 555 CDS 100% 10.800 15.120 N NEK3 n/a
2 TRCN0000001473 CGAAGCATAACACACCAAGAA pLKO.1 1227 CDS 100% 4.950 6.930 N NEK3 n/a
3 TRCN0000001471 GCAGTCCCATAGAACAGAAAT pLKO.1 2086 3UTR 100% 13.200 10.560 N NEK3 n/a
4 TRCN0000194828 CCCAATTTCCTCAACCATAAA pLKO.1 2169 3UTR 100% 13.200 9.240 N NEK3 n/a
5 TRCN0000001474 CCAGTTCACCAAATCTTCATA pLKO.1 1383 CDS 100% 5.625 3.938 N NEK3 n/a
6 TRCN0000197186 GCCGTCTCATTACTCCTATGA pLKO.1 1042 CDS 100% 4.950 3.465 N NEK3 n/a
7 TRCN0000001472 CCTTATTATGTGCCTCCAGAA pLKO.1 872 CDS 100% 4.050 2.835 N NEK3 n/a
8 TRCN0000197182 GTACCCTTAAGCATCCATTTC pLKO.1 963 CDS 100% 0.000 0.000 N NEK3 n/a
9 TRCN0000001475 CCTAGTCAAGCAGATGTTTAA pLKO.1 1072 CDS 100% 13.200 7.920 N NEK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14711 pDONR223 0% 96.6% 96.6% None 876_877ins51 n/a
2 ccsbBroad304_14711 pLX_304 0% 96.6% 96.6% V5 876_877ins51 n/a
3 TRCN0000465913 ACTGATCCGGAGACCTCTTGCGGG pLX_317 16.8% 96.6% 96.6% V5 876_877ins51 n/a
4 TRCN0000489322 TTTTATGGAACCTATCATTCAATT pLX_317 24.9% 96.6% 96.6% V5 (not translated due to prior stop codon) 876_877ins51 n/a
Download CSV