Transcript: Mouse NM_001146201.1

Mus musculus phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma (Pik3cg), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Pik3cg (30955)
Length:
6690
CDS:
201..3509

Additional Resources:

NCBI RefSeq record:
NM_001146201.1
NBCI Gene record:
Pik3cg (30955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361735 TGCCACAACGATCGCTCAAAT pLKO_005 2852 CDS 100% 13.200 18.480 N Pik3cg n/a
2 TRCN0000232404 GACGATCTCGTATTGAGTATC pLKO_005 3806 3UTR 100% 10.800 15.120 N Pik3cg n/a
3 TRCN0000368732 TACGCATCATGGAGTCCATTT pLKO_005 2743 CDS 100% 10.800 15.120 N Pik3cg n/a
4 TRCN0000024573 CCACAGTCCTATCCAACGAAA pLKO.1 2659 CDS 100% 4.950 6.930 N Pik3cg n/a
5 TRCN0000024571 CCCAAGTTATTTCACAGCTTA pLKO.1 2482 CDS 100% 4.950 6.930 N Pik3cg n/a
6 TRCN0000024572 GCTGTTAATAGACCACCGTTT pLKO.1 1598 CDS 100% 4.050 5.670 N Pik3cg n/a
7 TRCN0000361703 CAAGATCAGAGGCATTGATAT pLKO_005 1289 CDS 100% 13.200 9.240 N Pik3cg n/a
8 TRCN0000232401 CATAGCCACAGATCCACTTAA pLKO_005 1874 CDS 100% 13.200 9.240 N Pik3cg n/a
9 TRCN0000361704 CTCGTGTGTCCACCATGTATT pLKO_005 3869 3UTR 100% 13.200 9.240 N Pik3cg n/a
10 TRCN0000232402 GACGTCAGTTCCCAAGTTATT pLKO_005 2472 CDS 100% 13.200 9.240 N Pik3cg n/a
11 TRCN0000024570 CCTGCATTACTGGAAGTTGAT pLKO.1 563 CDS 100% 4.950 3.465 N Pik3cg n/a
12 TRCN0000232403 GTACCCTGGTGATCGAGAAAT pLKO_005 2581 CDS 100% 0.000 0.000 N Pik3cg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14762 pDONR223 0% 87% 94.1% None (many diffs) n/a
2 ccsbBroad304_14762 pLX_304 0% 87% 94.1% V5 (many diffs) n/a
3 TRCN0000480523 TACTATCAGTCTAGTTATCATTTA pLX_317 12.4% 87% 94% V5 (many diffs) n/a
4 ccsbBroadEn_06727 pDONR223 100% 87% 94% None (many diffs) n/a
5 ccsbBroad304_06727 pLX_304 0% 87% 94% V5 (many diffs) n/a
6 TRCN0000481299 CCCACTCTGTAACCGTTGCGGCCC pLX_317 13.1% 87% 94% V5 (many diffs) n/a
Download CSV