Transcript: Mouse NM_001159517.1

Mus musculus quaking (Qk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Qk (19317)
Length:
4658
CDS:
489..1514

Additional Resources:

NCBI RefSeq record:
NM_001159517.1
NBCI Gene record:
Qk (19317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233374 TAGGTGCGGTGGCTACTAAAG pLKO_005 1420 CDS 100% 10.800 15.120 N QKI n/a
2 TRCN0000102409 GAGCATCTAAATGAAGACTTA pLKO.1 921 CDS 100% 4.950 3.960 N Qk n/a
3 TRCN0000329417 ATGTACAATGACACGTTAAAT pLKO_005 654 CDS 100% 15.000 10.500 N Qk n/a
4 TRCN0000329482 CCTACAGAGACGCCAACATTA pLKO_005 1096 CDS 100% 13.200 9.240 N Qk n/a
5 TRCN0000102406 CCTAGAGGACTTACAGCTAAA pLKO.1 801 CDS 100% 10.800 7.560 N Qk n/a
6 TRCN0000329480 TCAATCCTTGAGTACCCTATT pLKO_005 1383 CDS 100% 10.800 7.560 N Qk n/a
7 TRCN0000015184 CCCTACCATAATGCCTTTGAT pLKO.1 1232 CDS 100% 5.625 3.938 N QKI n/a
8 TRCN0000015185 AGAAACTTTATGTGCCTGTAA pLKO.1 739 CDS 100% 4.950 3.465 N QKI n/a
9 TRCN0000015187 GACGAAGAAATTAGCAGAGTA pLKO.1 624 CDS 100% 4.950 3.465 N QKI n/a
10 TRCN0000102407 GCACCAGCTACATCAATCCTT pLKO.1 1371 CDS 100% 3.000 2.100 N Qk n/a
11 TRCN0000015183 GCTACATCAATCCTTGAGTAT pLKO.1 1377 CDS 100% 4.950 3.465 N QKI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02164 pDONR223 100% 96.3% 100% None (many diffs) n/a
2 ccsbBroad304_02164 pLX_304 0% 96.3% 100% V5 (many diffs) n/a
3 TRCN0000467894 CCTGACTCCGTGTACCCTTCACCC pLX_317 41.9% 96.3% 100% V5 (many diffs) n/a
Download CSV