Transcript: Mouse NM_001159551.1

Mus musculus histocompatibility 13 (H13), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
H13 (14950)
Length:
5402
CDS:
122..1306

Additional Resources:

NCBI RefSeq record:
NM_001159551.1
NBCI Gene record:
H13 (14950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030533 CTATGACATCTTCTGGGTATT pLKO.1 772 CDS 100% 10.800 15.120 N H13 n/a
2 TRCN0000278761 CTATGACATCTTCTGGGTATT pLKO_005 772 CDS 100% 10.800 15.120 N H13 n/a
3 TRCN0000030530 GAGATCATCAACTATGAGTTT pLKO.1 575 CDS 100% 4.950 3.465 N H13 n/a
4 TRCN0000278816 GAGATCATCAACTATGAGTTT pLKO_005 575 CDS 100% 4.950 3.465 N H13 n/a
5 TRCN0000030532 CACCATCTTCATCATGCACAT pLKO.1 1033 CDS 100% 4.050 2.835 N H13 n/a
6 TRCN0000297557 CACCATCTTCATCATGCACAT pLKO_005 1033 CDS 100% 4.050 2.835 N H13 n/a
7 TRCN0000030529 CCAGGAGTACATCAACCTCTT pLKO.1 412 CDS 100% 4.050 2.835 N H13 n/a
8 TRCN0000297555 CCAGGAGTACATCAACCTCTT pLKO_005 412 CDS 100% 4.050 2.835 N H13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04234 pDONR223 100% 85.6% 86.8% None (many diffs) n/a
2 ccsbBroad304_04234 pLX_304 0% 85.6% 86.8% V5 (many diffs) n/a
3 TRCN0000470515 TAATGTGCCTTCAAACGGCCTTCC pLX_317 37.9% 85.6% 86.8% V5 (many diffs) n/a
4 TRCN0000488993 TTATAGCGGGGCCCCGTCGCTGGC pLX_317 30.2% 85.5% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492118 TAGAATGGAGCGGACGGCAGTAGG pLX_317 31.7% 84.9% 86.5% V5 (many diffs) n/a
Download CSV