Transcript: Mouse NM_001159578.1

Mus musculus ligand of numb-protein X 1 (Lnx1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lnx1 (16924)
Length:
3098
CDS:
820..2529

Additional Resources:

NCBI RefSeq record:
NM_001159578.1
NBCI Gene record:
Lnx1 (16924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115125 CCAAGGTTGTTTCACCTGATT pLKO.1 1135 CDS 100% 4.950 6.930 N Lnx1 n/a
2 TRCN0000115124 CCCAAGGTTGTTTCACCTGAT pLKO.1 1134 CDS 100% 4.050 5.670 N Lnx1 n/a
3 TRCN0000115123 CGGTAGAAGTACATCGGGTAT pLKO.1 2421 CDS 100% 4.050 5.670 N Lnx1 n/a
4 TRCN0000115122 CCGGTCTTTCAAGAAGATCAA pLKO.1 1008 CDS 100% 4.950 3.465 N Lnx1 n/a
5 TRCN0000115121 CCATACTGTCATTTACCTATT pLKO.1 2820 3UTR 100% 10.800 6.480 N Lnx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468085 GTAGCGTAAGCGATGTAGCCATGT pLX_317 23.5% 76.8% 79.5% V5 (many diffs) n/a
2 ccsbBroadEn_10472 pDONR223 100% 76.6% 79.2% None (many diffs) n/a
3 ccsbBroad304_10472 pLX_304 0% 76.6% 79.2% V5 (many diffs) n/a
4 ccsbBroadEn_04419 pDONR223 100% 66.7% 69% None (many diffs) n/a
5 ccsbBroad304_04419 pLX_304 0% 66.7% 69% V5 (many diffs) n/a
6 TRCN0000470105 CTACATTACTGCATGCACCGCTGG pLX_317 15.9% 66.7% 69% V5 (many diffs) n/a
Download CSV