Transcript: Mouse NM_001159593.1

Mus musculus solute carrier family 20, member 1 (Slc20a1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc20a1 (20515)
Length:
2019
CDS:
491..1228

Additional Resources:

NCBI RefSeq record:
NM_001159593.1
NBCI Gene record:
Slc20a1 (20515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313521 TCCGCTGCTTTCTGGTATTAT pLKO_005 997 CDS 100% 15.000 21.000 N Slc20a1 n/a
2 TRCN0000068404 CCCATTGTATTGTCGGTGCAA pLKO.1 891 CDS 100% 2.640 3.696 N Slc20a1 n/a
3 TRCN0000317138 CCCATTGTATTGTCGGTGCAA pLKO_005 891 CDS 100% 2.640 3.696 N Slc20a1 n/a
4 TRCN0000068403 CCACCGAAGTATGACAATCTA pLKO.1 548 CDS 100% 5.625 3.938 N Slc20a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159593.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01551 pDONR223 100% 30.1% 29.8% None (many diffs) n/a
2 ccsbBroad304_01551 pLX_304 0% 30.1% 29.8% V5 (many diffs) n/a
3 TRCN0000479800 ACTTAGTCTTTACCCATGGCTTCA pLX_317 9.1% 30.1% 29.8% V5 (many diffs) n/a
Download CSV