Transcript: Mouse NM_001159731.1

Mus musculus retinoid X receptor gamma (Rxrg), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rxrg (20183)
Length:
1695
CDS:
304..1326

Additional Resources:

NCBI RefSeq record:
NM_001159731.1
NBCI Gene record:
Rxrg (20183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222382 GCTGTTTAACCCAGATGCCAA pLKO.1 1059 CDS 100% 2.640 3.696 N Rxrg n/a
2 TRCN0000438766 GTGGCCCTTCTTTGCTATTTA pLKO_005 1517 3UTR 100% 15.000 12.000 N Rxrg n/a
3 TRCN0000222384 CATCTACACCTGTCGGGATAA pLKO.1 447 CDS 100% 10.800 7.560 N Rxrg n/a
4 TRCN0000445690 GACTCTTCGAGAGAAGGTTTA pLKO_005 1107 CDS 100% 10.800 7.560 N Rxrg n/a
5 TRCN0000222383 CGGTGACATGAACGTGGAGAA pLKO.1 693 CDS 100% 4.050 2.835 N Rxrg n/a
6 TRCN0000222385 CCAAGATGAAAGACATGCAGA pLKO.1 1001 CDS 100% 2.640 1.848 N Rxrg n/a
7 TRCN0000338870 ATGACCCTGTTACCAACATAT pLKO_005 722 CDS 100% 13.200 6.600 Y RXRG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01470 pDONR223 100% 66% 72.5% None (many diffs) n/a
2 ccsbBroad304_01470 pLX_304 0% 66% 72.5% V5 (many diffs) n/a
3 TRCN0000478997 TGAGATGGCGAACCGTTGGAATAG pLX_317 16.8% 66% 72.5% V5 (many diffs) n/a
Download CSV