Transcript: Human NM_001159736.1

Homo sapiens BUD13 homolog (BUD13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
BUD13 (84811)
Length:
1814
CDS:
35..1492

Additional Resources:

NCBI RefSeq record:
NM_001159736.1
NBCI Gene record:
BUD13 (84811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423572 ACAGTTGTCTGTGCTAATAAT pLKO_005 1560 3UTR 100% 15.000 21.000 N BUD13 n/a
2 TRCN0000412677 ATTTGAAACTCGAACGTTTAG pLKO_005 1047 CDS 100% 10.800 15.120 N BUD13 n/a
3 TRCN0000428125 TGTTGAGGATATGTAACTTTC pLKO_005 1477 CDS 100% 10.800 15.120 N BUD13 n/a
4 TRCN0000074896 CGAGTATCTGAAGCGTTACTT pLKO.1 64 CDS 100% 5.625 7.875 N BUD13 n/a
5 TRCN0000074894 GCCCGCTATATTGATGACGAA pLKO.1 1199 CDS 100% 2.640 3.696 N BUD13 n/a
6 TRCN0000431033 CAATATGCTGAAACCGTATTT pLKO_005 1001 CDS 100% 13.200 9.240 N BUD13 n/a
7 TRCN0000074897 CCGCTATATTGATGACGAAGA pLKO.1 1201 CDS 100% 4.050 2.835 N BUD13 n/a
8 TRCN0000074893 CCTGATGTTTGGACTGAGGTA pLKO.1 1644 3UTR 100% 2.640 1.848 N BUD13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09225 pDONR223 100% 78.2% 78.3% None 480G>A;632_633ins402 n/a
2 ccsbBroad304_09225 pLX_304 0% 78.2% 78.3% V5 480G>A;632_633ins402 n/a
3 TRCN0000465583 AGTTCATCCGGCCACCCTCAACCA pLX_317 20.1% 78.2% 78.3% V5 480G>A;632_633ins402 n/a
Download CSV