Transcript: Human NM_001161564.3

Homo sapiens TRAF2 and NCK interacting kinase (TNIK), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
TNIK (23043)
Length:
9703
CDS:
343..4236

Additional Resources:

NCBI RefSeq record:
NM_001161564.3
NBCI Gene record:
TNIK (23043)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146101 AGCAACGAGCAGTACAATGT pXPR_003 GGG 2438 63% 21 0.7521 TNIK TNIK 75850
2 BRDN0001149026 CTCGGCTGAAGTCTAAGAAG pXPR_003 TGG 768 20% 9 0.5993 TNIK TNIK 75851
3 BRDN0001149184 GTTGGTCATCCATGCCTGGT pXPR_003 GGG 284 7% 4 0.3208 TNIK TNIK 75852
4 BRDN0001146045 TGCTCAGCTTGATCGAACAG pXPR_003 TGG 541 14% 7 -0.0367 TNIK TNIK 75849
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001161564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199743 GACAGTTTCAGCGGCAGTATT pLKO.1 2824 CDS 100% 13.200 18.480 N TNIK n/a
2 TRCN0000196798 GCTCCTAAACCGTATCATAAA pLKO.1 3667 CDS 100% 13.200 18.480 N TNIK n/a
3 TRCN0000199940 GCGAACTTCTTAGGCAAGAAC pLKO.1 3164 CDS 100% 0.495 0.693 N TNIK n/a
4 TRCN0000234733 GGGCAAGGCAAAGTCTATAAT pLKO_005 3376 CDS 100% 15.000 12.000 N TNIK n/a
5 TRCN0000037518 CCATCTCATATTCAGGGCAAT pLKO.1 3844 CDS 100% 4.050 3.240 N TNIK n/a
6 TRCN0000037516 CGAGCAGTACAATGTGGGAAT pLKO.1 2769 CDS 100% 4.050 3.240 N TNIK n/a
7 TRCN0000196657 GACATTTGGATGGAGTATTTA pLKO.1 4082 CDS 100% 15.000 10.500 N TNIK n/a
8 TRCN0000196882 GCTCTACTTCTGGAATATAAG pLKO.1 1750 CDS 100% 13.200 9.240 N TNIK n/a
9 TRCN0000234731 TAAAGTGATTCATCGAGATAT pLKO_005 783 CDS 100% 13.200 9.240 N TNIK n/a
10 TRCN0000234732 TTCAACTCAAGGACCATATTG pLKO_005 1241 CDS 100% 13.200 9.240 N TNIK n/a
11 TRCN0000234735 CACGGTAGAAGAAGGTCAAAG pLKO_005 3744 CDS 100% 10.800 7.560 N TNIK n/a
12 TRCN0000199351 CTTGCAGCCATCAAGGTTATG pLKO.1 490 CDS 100% 10.800 7.560 N TNIK n/a
13 TRCN0000196774 GCTACGAGTTTACTATCTTTC pLKO.1 3480 CDS 100% 10.800 7.560 N TNIK n/a
14 TRCN0000234734 GCTACGAGTTTACTATCTTTC pLKO_005 3480 CDS 100% 10.800 7.560 N TNIK n/a
15 TRCN0000196440 GCTATTGTCATCTTGCCTAAA pLKO.1 3877 CDS 100% 10.800 7.560 N TNIK n/a
16 TRCN0000037514 CGGTAGAAGAAGGTCAAAGAT pLKO.1 3746 CDS 100% 5.625 3.938 N TNIK n/a
17 TRCN0000037517 GCCTCAAAGAACAACTTCTAT pLKO.1 2193 CDS 100% 5.625 3.938 N TNIK n/a
18 TRCN0000037515 CCAGAAGTTATTGCCTGTGAT pLKO.1 931 CDS 100% 4.950 3.465 N TNIK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161564.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492337 ACACGTCCGAGTCATCCTGCGGAC pLX_317 8.7% 93.2% 93.2% V5 (many diffs) n/a
Download CSV