Transcript: Human NM_001161577.2

Homo sapiens sterile alpha motif domain containing 4A (SAMD4A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SAMD4A (23034)
Length:
5522
CDS:
117..1154

Additional Resources:

NCBI RefSeq record:
NM_001161577.2
NBCI Gene record:
SAMD4A (23034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001161577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184529 GCAGAAGCTCTTTCGGTCTTT pLKO.1 536 CDS 100% 4.950 3.960 N Samd4 n/a
2 TRCN0000116144 GCTCATAGACAAGTGTCTAAT pLKO.1 458 CDS 100% 1.320 0.924 N SAMD4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161577.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15747 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15747 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465896 TGGTACACAGTCATTTGCATACCT pLX_317 39.4% 100% 100% V5 n/a
4 ccsbBroadEn_07831 pDONR223 100% 46.4% 46.4% None 0_1ins960;816_923del n/a
5 ccsbBroad304_07831 pLX_304 0% 46.4% 46.4% V5 0_1ins960;816_923del n/a
6 TRCN0000491644 TAACATCATGGATAGATATGTGGT pLX_317 18.5% 46.4% 46.4% V5 0_1ins960;816_923del n/a
Download CSV