Transcript: Mouse NM_001161618.1

Mus musculus cullin 5 (Cul5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Cul5 (75717)
Length:
5942
CDS:
222..2708

Additional Resources:

NCBI RefSeq record:
NM_001161618.1
NBCI Gene record:
Cul5 (75717)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006538 GCAGACTGAATTAGTAGAAAT pLKO.1 2567 CDS 100% 13.200 18.480 N CUL5 n/a
2 TRCN0000012796 CGAGAGTCCTATGTTAATCTT pLKO.1 987 CDS 100% 5.625 4.500 N Cul5 n/a
3 TRCN0000012794 GCAAGAGATAAGGCATATAAA pLKO.1 1467 CDS 100% 15.000 10.500 N Cul5 n/a
4 TRCN0000012795 CCATCTCATGTCAAATGGAAT pLKO.1 2087 CDS 100% 4.950 3.465 N Cul5 n/a
5 TRCN0000012793 CCCTTCATGTTGCACACTCTT pLKO.1 2876 3UTR 100% 4.950 3.465 N Cul5 n/a
6 TRCN0000006539 GCTAGAATGTTTCAGGACATA pLKO.1 1845 CDS 100% 4.950 3.465 N CUL5 n/a
7 TRCN0000293505 GCTAGAATGTTTCAGGACATA pLKO_005 1845 CDS 100% 4.950 3.465 N CUL5 n/a
8 TRCN0000012797 GCTTGCCAATTACTGTGACAT pLKO.1 1586 CDS 100% 4.950 3.465 N Cul5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07198 pDONR223 100% 79.8% 86.6% None (many diffs) n/a
2 ccsbBroad304_07198 pLX_304 0% 79.8% 86.6% V5 (many diffs) n/a
3 TRCN0000478636 CATACGCCTTTGGTCTGACAGTTC pLX_317 15.1% 79.8% 86.6% V5 (many diffs) n/a
Download CSV