Transcript: Mouse NM_001161796.1

Mus musculus guanylate cyclase 1, soluble, beta 3 (Gucy1b3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Gucy1b3 (54195)
Length:
3234
CDS:
138..1967

Additional Resources:

NCBI RefSeq record:
NM_001161796.1
NBCI Gene record:
Gucy1b3 (54195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361655 TGCCTAGACGGACGTTCTAAA pLKO_005 2254 3UTR 100% 13.200 18.480 N Gucy1b3 n/a
2 TRCN0000028802 CCATTTGTTTACAAGGTGGAA pLKO.1 1536 CDS 100% 2.640 3.696 N Gucy1b3 n/a
3 TRCN0000028790 GCCAGTTTCTTGTCAGAATAA pLKO.1 241 CDS 100% 13.200 9.240 N Gucy1b3 n/a
4 TRCN0000361656 TTGCGTGTCCTGGGATCTAAT pLKO_005 396 CDS 100% 13.200 9.240 N Gucy1b3 n/a
5 TRCN0000361722 ACGATCTCTACACCCGATTTG pLKO_005 1489 CDS 100% 10.800 7.560 N Gucy1b3 n/a
6 TRCN0000028791 GAAACAAATGAGGAGGATGAA pLKO.1 1957 CDS 100% 4.950 3.465 N Gucy1b3 n/a
7 TRCN0000028832 GCTGGTCAAGTTCAAGTAGAT pLKO.1 1656 CDS 100% 4.950 3.465 N Gucy1b3 n/a
8 TRCN0000028770 TCACACATCAATACAGTCTTT pLKO.1 945 CDS 100% 4.950 3.465 N Gucy1b3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06343 pDONR223 100% 87.3% 92.8% None (many diffs) n/a
2 ccsbBroad304_06343 pLX_304 0% 87.3% 92.8% V5 (many diffs) n/a
3 TRCN0000491416 CGAAAAGATGCCAAGAGCTTAATC pLX_317 19% 87.3% 92.8% V5 (many diffs) n/a
Download CSV