Transcript: Human NM_001163280.1

Homo sapiens HIV-1 Tat specific factor 1 (HTATSF1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
HTATSF1 (27336)
Length:
3037
CDS:
423..2690

Additional Resources:

NCBI RefSeq record:
NM_001163280.1
NBCI Gene record:
HTATSF1 (27336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163280.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006590 GCTACATATCAGGCCAATTAT pLKO.1 627 CDS 100% 15.000 21.000 N HTATSF1 n/a
2 TRCN0000006588 CGCATCTAGTTCTACCGCAAA pLKO.1 665 CDS 100% 4.050 5.670 N HTATSF1 n/a
3 TRCN0000293331 CGCATCTAGTTCTACCGCAAA pLKO_005 665 CDS 100% 4.050 5.670 N HTATSF1 n/a
4 TRCN0000006589 GCAACTGGAATGGCGTTTGAA pLKO.1 1671 CDS 100% 5.625 4.500 N HTATSF1 n/a
5 TRCN0000293332 GCAACTGGAATGGCGTTTGAA pLKO_005 1671 CDS 100% 5.625 4.500 N HTATSF1 n/a
6 TRCN0000006587 GCCATCAGATTAAAGCATTGA pLKO.1 2793 3UTR 100% 4.950 3.960 N HTATSF1 n/a
7 TRCN0000293277 ATCCAGAGGAAGCTGATTATT pLKO_005 1384 CDS 100% 15.000 10.500 N HTATSF1 n/a
8 TRCN0000293330 GCCTGTGCTTCAGGGTAATTA pLKO_005 2734 3UTR 100% 15.000 10.500 N HTATSF1 n/a
9 TRCN0000006591 CCGAAAGAGAATTTGAAGAAA pLKO.1 2104 CDS 100% 5.625 3.938 N HTATSF1 n/a
10 TRCN0000293275 CCGAAAGAGAATTTGAAGAAA pLKO_005 2104 CDS 100% 5.625 3.938 N HTATSF1 n/a
11 TRCN0000255328 CGATGATGATGACGATGATAA pLKO_005 2666 CDS 100% 13.200 6.600 Y Sbpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163280.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03032 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03032 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481334 AGTACACGATGTTCACGGGATGTC pLX_317 20.1% 99.8% 80.3% V5 (not translated due to prior stop codon) 1816_1818delGGCinsCAG;1822delG n/a
Download CSV