Transcript: Human NM_001163322.2

Homo sapiens coiled-coil domain containing 120 (CCDC120), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-11-18
Taxon:
Homo sapiens (human)
Gene:
CCDC120 (90060)
Length:
3593
CDS:
296..2245

Additional Resources:

NCBI RefSeq record:
NM_001163322.2
NBCI Gene record:
CCDC120 (90060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166502 CCCTTCTGATATGTCCCTTGT pLKO.1 2247 3UTR 100% 4.050 3.240 N CCDC120 n/a
2 TRCN0000426376 CCACCTCCATCAGATCTTTAT pLKO_005 1052 CDS 100% 13.200 9.240 N CCDC120 n/a
3 TRCN0000165517 GCAAACCTGAAGGCCTTCATT pLKO.1 1212 CDS 100% 5.625 3.938 N CCDC120 n/a
4 TRCN0000158665 CCTCCATTTATGTTTACAGTT pLKO.1 2505 3UTR 100% 4.950 3.465 N CCDC120 n/a
5 TRCN0000165729 CCTCTTGGACTATTCCTTGGA pLKO.1 1588 CDS 100% 2.640 1.848 N CCDC120 n/a
6 TRCN0000240867 GAGACTTCCTCTTGGACTATC pLKO_005 1581 CDS 100% 10.800 7.560 N Ccdc120 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3325 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3325 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163322.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04504 pDONR223 100% 93.2% 92.8% None (many diffs) n/a
2 ccsbBroad304_04504 pLX_304 0% 93.2% 92.8% V5 (many diffs) n/a
3 TRCN0000474151 CCGGCAGTATCTGTGATATCTACG pLX_317 16% 93.2% 92.8% V5 (many diffs) n/a
Download CSV