Transcript: Mouse NM_001163330.1

Mus musculus RALY RNA binding protein-like (Ralyl), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ralyl (76897)
Length:
1846
CDS:
125..619

Additional Resources:

NCBI RefSeq record:
NM_001163330.1
NBCI Gene record:
Ralyl (76897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112041 GCTTGAATCAAAGGAGCCATT pLKO.1 238 CDS 100% 4.050 3.240 N Ralyl n/a
2 TRCN0000112043 CGATTACTACAGAGATGATTT pLKO.1 289 CDS 100% 13.200 9.240 N Ralyl n/a
3 TRCN0000112040 GCTATATTTCTGCCCTCTATA pLKO.1 1104 3UTR 100% 13.200 9.240 N Ralyl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04914 pDONR223 100% 48.3% 48.9% None (many diffs) n/a
2 ccsbBroad304_04914 pLX_304 0% 48.3% 48.9% V5 (many diffs) n/a
3 TRCN0000481554 CGAAGTCCTTGCTTCCGCCAACTT pLX_317 49% 48.3% 48.9% V5 (many diffs) n/a
Download CSV