Transcript: Mouse NM_001163643.1

Mus musculus mitogen-activated protein kinase kinase kinase 12 (Map3k12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Map3k12 (26404)
Length:
5528
CDS:
428..3094

Additional Resources:

NCBI RefSeq record:
NM_001163643.1
NBCI Gene record:
Map3k12 (26404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231655 CCACGAAATCGCCCATCATTC pLKO_005 1577 CDS 100% 10.800 15.120 N MAP3K12 n/a
2 TRCN0000322150 CCACGAAATCGCCCATCATTC pLKO_005 1577 CDS 100% 10.800 15.120 N Map3k12 n/a
3 TRCN0000022573 GCGTCAGTCACTATCTACATT pLKO.1 2758 CDS 100% 5.625 7.875 N Map3k12 n/a
4 TRCN0000022572 CCCATCATTCCGACAGATCTT pLKO.1 1588 CDS 100% 4.950 6.930 N Map3k12 n/a
5 TRCN0000197106 GCACTGAATTGGACAACTCCA pLKO.1 3030 CDS 100% 2.640 3.696 N MAP3K12 n/a
6 TRCN0000022569 GCTGTGAAGAAGGTTCGAGAT pLKO.1 974 CDS 100% 4.050 3.240 N Map3k12 n/a
7 TRCN0000345133 ACCTGCACCTGCACAAGATTA pLKO_005 1203 CDS 100% 13.200 9.240 N Map3k12 n/a
8 TRCN0000367594 ACCTGCACCTGCACAAGATTA pLKO_005 1203 CDS 100% 13.200 9.240 N MAP3K12 n/a
9 TRCN0000345134 TCCATGAAAGACACTCTTATT pLKO_005 3088 CDS 100% 13.200 9.240 N Map3k12 n/a
10 TRCN0000322075 CAGAGTCGTTGCTACCTAAAC pLKO_005 2058 CDS 100% 10.800 7.560 N Map3k12 n/a
11 TRCN0000322138 CTGGAGAGATTCCCTACAAAG pLKO_005 1440 CDS 100% 10.800 7.560 N Map3k12 n/a
12 TRCN0000322072 GGGCTTTGTGTCTACTCTAAG pLKO_005 472 CDS 100% 10.800 7.560 N Map3k12 n/a
13 TRCN0000353172 TGGAACAGCAAACCACGAAAT pLKO_005 1565 CDS 100% 10.800 7.560 N Map3k12 n/a
14 TRCN0000367516 TGGACATCAGGGAGCACTATG pLKO_005 1794 CDS 100% 10.800 7.560 N MAP3K12 n/a
15 TRCN0000022571 CTACTCTAAGTGAGGCTTCTA pLKO.1 483 CDS 100% 4.950 3.465 N Map3k12 n/a
16 TRCN0000022570 CCTAAACTAGATGCAGCCCTA pLKO.1 2072 CDS 100% 2.160 1.512 N Map3k12 n/a
17 TRCN0000367575 TGTGGTGAAGATCTCAGATTT pLKO_005 1270 CDS 100% 13.200 7.920 N MAP3K12 n/a
18 TRCN0000000999 GCGCCACATAATCAACAGAAA pLKO.1 3148 3UTR 100% 4.950 6.930 N MAP3K12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491519 CTTACGAAATCTTTTTAATGGCCG pLX_317 15.3% 68.5% 73.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14884 pDONR223 0% 55.8% 57.8% None (many diffs) n/a
3 ccsbBroad304_14884 pLX_304 0% 55.8% 57.8% V5 (many diffs) n/a
4 TRCN0000472349 TTCTTGGTCAAGTATAGATATGCC pLX_317 20.8% 55.8% 57.8% V5 (many diffs) n/a
5 TRCN0000466223 ACCATACTTGTCTATGTCGTCGGC pLX_317 20.8% 55.7% 57.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_13986 pDONR223 100% 55.5% 57.6% None (many diffs) n/a
7 ccsbBroad304_13986 pLX_304 0% 55.5% 57.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV