Transcript: Mouse NM_001163700.1

Mus musculus nuclear receptor subfamily 1, group H, member 4 (Nr1h4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nr1h4 (20186)
Length:
1985
CDS:
43..1509

Additional Resources:

NCBI RefSeq record:
NM_001163700.1
NBCI Gene record:
Nr1h4 (20186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233425 GGTATCTCTGATGAGTATATA pLKO_005 1156 CDS 100% 15.000 21.000 N Nr1h4 n/a
2 TRCN0000233426 TACACCTCCCACGGTTGTAAA pLKO_005 1615 3UTR 100% 13.200 18.480 N Nr1h4 n/a
3 TRCN0000233424 TTCTTCGTTCGGCGGAGATTT pLKO_005 1076 CDS 100% 13.200 18.480 N Nr1h4 n/a
4 TRCN0000026012 CGCCGTGTACAAGTGTAAGAA pLKO.1 549 CDS 100% 5.625 4.500 N Nr1h4 n/a
5 TRCN0000233423 CAGACCCTCCTGGATTATATT pLKO_005 838 CDS 100% 15.000 10.500 N Nr1h4 n/a
6 TRCN0000375723 GCCTCAGGAAATCACAAATAA pLKO_005 885 CDS 100% 15.000 10.500 N Nr1h4 n/a
7 TRCN0000026000 CCCGATGTTCAGTTTCTATAA pLKO.1 1179 CDS 100% 13.200 9.240 N Nr1h4 n/a
8 TRCN0000375724 ACCTGGTTTCACTCAAGAATC pLKO_005 1569 3UTR 100% 10.800 7.560 N Nr1h4 n/a
9 TRCN0000025990 GCTGATGTCTTGGAGAGTGAA pLKO.1 1440 CDS 100% 4.950 3.465 N Nr1h4 n/a
10 TRCN0000026027 CCATACAACAATGTCCCGTTT pLKO.1 214 CDS 100% 4.050 2.835 N Nr1h4 n/a
11 TRCN0000233422 TTTCCTCCTCGTCTTACTATT pLKO_005 254 CDS 100% 13.200 7.920 N Nr1h4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11439 pDONR223 100% 81.8% 87.3% None (many diffs) n/a
2 ccsbBroad304_11439 pLX_304 0% 81.8% 87.3% V5 (many diffs) n/a
3 TRCN0000478769 CCTGCACGGCTATTCGTGCAAAGC pLX_317 26.7% 81.8% 87.3% V5 (many diffs) n/a
4 TRCN0000487815 AATGACCCCCAGAGAGCGCTTGTC pLX_317 21.5% 81% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487841 CATACGGGGACCCGAGTTGCTATC pLX_317 17.4% 80.9% 86.3% V5 (many diffs) n/a
Download CSV