Transcript: Mouse NM_001163775.1

Mus musculus TAO kinase 2 (Taok2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Taok2 (381921)
Length:
5270
CDS:
1099..4821

Additional Resources:

NCBI RefSeq record:
NM_001163775.1
NBCI Gene record:
Taok2 (381921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148565 TCAAGACAGACCAACCTCAG pXPR_003 AGG 814 22% 10 0.5108 Taok2 TAOK2 77249
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025223 CCAATAAGAATGGTTTCCGAA pLKO.1 4472 CDS 100% 2.640 2.112 N Taok2 n/a
2 TRCN0000025222 GCCATGGATGAGGGACAATAT pLKO.1 1684 CDS 100% 13.200 9.240 N Taok2 n/a
3 TRCN0000233517 GTCTGAGTACTTCCGGAATTT pLKO_005 1848 CDS 100% 13.200 9.240 N TAOK2 n/a
4 TRCN0000025220 CGAGACCACTTTGCTACCATT pLKO.1 2506 CDS 100% 4.950 3.465 N Taok2 n/a
5 TRCN0000025219 GCATCCTAATACCATTCAGTA pLKO.1 1350 CDS 100% 4.950 3.465 N Taok2 n/a
6 TRCN0000025221 CGAGAGGACTTGAATAAGAAA pLKO.1 3106 CDS 100% 5.625 3.375 N Taok2 n/a
7 TRCN0000195627 CCATCAAGAAGATGTCCTACA pLKO.1 1262 CDS 100% 4.050 2.835 N TAOK2 n/a
8 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 3817 CDS 100% 4.950 2.475 Y PTMA n/a
9 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 2263 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.