Transcript: Human NM_001163989.1

Homo sapiens RAB37, member RAS oncogene family (RAB37), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RAB37 (326624)
Length:
2847
CDS:
191..877

Additional Resources:

NCBI RefSeq record:
NM_001163989.1
NBCI Gene record:
RAB37 (326624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380389 AGCGTCACCCATGCTTATTAC pLKO_005 485 CDS 100% 13.200 18.480 N RAB37 n/a
2 TRCN0000047904 GCAGCGAAAGAGTGATCCGTT pLKO.1 648 CDS 100% 2.640 3.696 N RAB37 n/a
3 TRCN0000047907 CCGAAGCGTCACCCATGCTTA pLKO.1 481 CDS 100% 1.650 2.310 N RAB37 n/a
4 TRCN0000380700 CATCGCCAAGGAACTGAAATA pLKO_005 763 CDS 100% 13.200 9.240 N RAB37 n/a
5 TRCN0000381942 GCTAGGCAACAAGGCGGATAT pLKO_005 625 CDS 100% 10.800 7.560 N RAB37 n/a
6 TRCN0000379684 GCTTCCAGATCCGAGACTATG pLKO_005 813 CDS 100% 10.800 7.560 N Rab37 n/a
7 TRCN0000380200 CGCTCTCCAGGAGCTTATCTT pLKO_005 1343 3UTR 100% 5.625 3.938 N RAB37 n/a
8 TRCN0000047906 AGCTTCCAGATCCGAGACTAT pLKO.1 812 CDS 100% 4.950 3.465 N RAB37 n/a
9 TRCN0000047905 CTATGTAGAGTCCCAGAAGAA pLKO.1 829 CDS 100% 4.950 3.465 N RAB37 n/a
10 TRCN0000047903 CAACAAATCTTCTTTCGACAA pLKO.1 544 CDS 100% 4.050 2.835 N RAB37 n/a
11 TRCN0000380717 TGTATGACATCACCAACAAAT pLKO_005 531 CDS 100% 13.200 7.920 N RAB37 n/a
12 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1944 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
13 TRCN0000165833 GCTCACTACAACCTCCACTTT pLKO.1 1759 3UTR 100% 4.950 2.475 Y LINC00346 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05423 pDONR223 100% 91.6% 87.8% None (many diffs) n/a
2 ccsbBroad304_05423 pLX_304 0% 91.6% 87.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000471971 ACTCCGCCGCGTCAATCGCGAACT pLX_317 71.7% 91.6% 87.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV