Transcript: Mouse NM_001164086.1

Mus musculus homer scaffolding protein 2 (Homer2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Homer2 (26557)
Length:
10966
CDS:
163..1194

Additional Resources:

NCBI RefSeq record:
NM_001164086.1
NBCI Gene record:
Homer2 (26557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108512 CCCGAACATGACTTTCACCAA pLKO.1 348 CDS 100% 2.640 3.696 N Homer2 n/a
2 TRCN0000316532 CCCGAACATGACTTTCACCAA pLKO_005 348 CDS 100% 2.640 3.696 N Homer2 n/a
3 TRCN0000202185 CCATCAGGAAGCATCGATCAA pLKO.1 9035 3UTR 100% 4.950 3.960 N Homer2 n/a
4 TRCN0000191065 CAATTATGTAAAGCTCTCTCT pLKO.1 8892 3UTR 100% 2.640 2.112 N Homer2 n/a
5 TRCN0000190962 CTGCACACAAGTCCATTTCAT pLKO.1 9090 3UTR 100% 5.625 3.938 N Homer2 n/a
6 TRCN0000108510 CATTCTCCATTTGCTTCTGTA pLKO.1 1240 3UTR 100% 4.950 3.465 N Homer2 n/a
7 TRCN0000316500 CATTCTCCATTTGCTTCTGTA pLKO_005 1240 3UTR 100% 4.950 3.465 N Homer2 n/a
8 TRCN0000108513 CGTCACGGTTTCCTACTTCTA pLKO.1 255 CDS 100% 4.950 3.465 N Homer2 n/a
9 TRCN0000316498 CGTCACGGTTTCCTACTTCTA pLKO_005 255 CDS 100% 4.950 3.465 N Homer2 n/a
10 TRCN0000108511 GCGGTCTCTAAAGACAGACAT pLKO.1 1044 CDS 100% 4.950 3.465 N Homer2 n/a
11 TRCN0000316499 GCGGTCTCTAAAGACAGACAT pLKO_005 1044 CDS 100% 4.950 3.465 N Homer2 n/a
12 TRCN0000201850 GCATCGATCAATCTACCTCAT pLKO.1 9045 3UTR 100% 4.050 2.835 N Homer2 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8938 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164086.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487765 TTCTTGTGTCTAGGATACTCTTTC pLX_317 22.6% 89.8% 94.4% V5 (many diffs) n/a
2 TRCN0000488563 ACTTACCTTGTCAGGAAGGGAAGC pLX_317 35.3% 89.8% 94.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV