Transcript: Mouse NM_001164172.1

Mus musculus mitogen-activated protein kinase kinase 7 (Map2k7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Mus musculus (mouse)
Gene:
Map2k7 (26400)
Length:
3556
CDS:
171..1478

Additional Resources:

NCBI RefSeq record:
NM_001164172.1
NBCI Gene record:
Map2k7 (26400)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321041 GATGTCGCGTCCTGGTTTAAG pLKO_005 1383 CDS 100% 13.200 18.480 N Map2k7 n/a
2 TRCN0000321014 GTCAAAGACTGCCTTACTAAA pLKO_005 1287 CDS 100% 13.200 18.480 N Map2k7 n/a
3 TRCN0000350455 GTCAAAGACTGCCTTACTAAA pLKO_005 1287 CDS 100% 13.200 18.480 N MAP2K7 n/a
4 TRCN0000360319 CATGAGCAGACTCGCTATTTA pLKO_005 1756 3UTR 100% 15.000 12.000 N Map2k7 n/a
5 TRCN0000012611 CCAGCGTTATCAGGCAGAAAT pLKO.1 548 CDS 100% 13.200 9.240 N Map2k7 n/a
6 TRCN0000320975 TCACCAACACAGACGTCTTTA pLKO_005 778 CDS 100% 13.200 9.240 N Map2k7 n/a
7 TRCN0000315338 AGAACTGCAAGACGGACTTTG pLKO_005 1186 CDS 100% 10.800 7.560 N MAP2K7 n/a
8 TRCN0000360372 AGAACTGCAAGACGGACTTTG pLKO_005 1186 CDS 100% 10.800 7.560 N Map2k7 n/a
9 TRCN0000360390 AGGAAGAGAATAAGCGCATTT pLKO_005 688 CDS 100% 10.800 7.560 N Map2k7 n/a
10 TRCN0000321042 GTATGGAGAGCATCGAGATTG pLKO_005 475 CDS 100% 10.800 7.560 N Map2k7 n/a
11 TRCN0000001079 CACAGGAAGAGACCAAAGTAT pLKO.1 1311 CDS 100% 5.625 3.938 N MAP2K7 n/a
12 TRCN0000012609 CCTTACATCGTTCAGTGCTTT pLKO.1 747 CDS 100% 4.950 3.465 N Map2k7 n/a
13 TRCN0000012612 CGATGTCAAACCCTCCAACAT pLKO.1 944 CDS 100% 4.950 3.465 N Map2k7 n/a
14 TRCN0000380424 CAGACACTGTGAACGGAAGAC pLKO_005 1728 3UTR 100% 4.050 2.835 N MAP2K7 n/a
15 TRCN0000012610 CATTTGTCAAAGACTGCCTTA pLKO.1 1282 CDS 100% 4.050 2.835 N Map2k7 n/a
16 TRCN0000321043 CCAAGGACTGAGGACAGAAAG pLKO_005 1588 3UTR 100% 10.800 6.480 N Map2k7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14811 pDONR223 0% 85.5% 93.4% None (many diffs) n/a
2 ccsbBroad304_14811 pLX_304 0% 85.5% 93.4% V5 (many diffs) n/a
3 TRCN0000479770 GCAAAGCTAGGTTCCCCTATATCG pLX_317 26% 85.4% 93.2% V5 (many diffs) n/a
4 TRCN0000488353 GCTTAAACCCCCTGTGTGAACCAC pLX_317 26% 85.5% 93.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV