Transcript: Mouse NM_001164367.1

Mus musculus RAB11 family interacting protein 2 (class I) (Rab11fip2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab11fip2 (74998)
Length:
5373
CDS:
219..1331

Additional Resources:

NCBI RefSeq record:
NM_001164367.1
NBCI Gene record:
Rab11fip2 (74998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183681 GCAGCATGAATTTATTCTCAA pLKO.1 793 CDS 100% 4.950 3.960 N Rab11fip2 n/a
2 TRCN0000179614 GCCCATTCGATGTCTGATTTA pLKO.1 465 CDS 100% 13.200 9.240 N Rab11fip2 n/a
3 TRCN0000179361 GTCCCACTTATCTTCTGAGAA pLKO.1 491 CDS 100% 4.950 3.465 N Rab11fip2 n/a
4 TRCN0000183097 CCAAGGAAGAAGAATCCATTT pLKO.1 747 CDS 100% 10.800 6.480 N Rab11fip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07808 pDONR223 100% 63.4% 65.8% None (many diffs) n/a
2 ccsbBroad304_07808 pLX_304 0% 63.4% 65.8% V5 (many diffs) n/a
3 TRCN0000480957 CGTTGCAATGCGTTTACACTAGGA pLX_317 24.4% 63.4% 65.8% V5 (many diffs) n/a
Download CSV