Transcript: Mouse NM_001164611.1

Mus musculus sphingomyelin phosphodiesterase 4 (Smpd4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Smpd4 (77626)
Length:
4542
CDS:
127..2508

Additional Resources:

NCBI RefSeq record:
NM_001164611.1
NBCI Gene record:
Smpd4 (77626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124166 CCCAATGTTTGGTCCTGAAAT pLKO.1 1653 CDS 100% 13.200 18.480 N Smpd4 n/a
2 TRCN0000302443 CCCAATGTTTGGTCCTGAAAT pLKO_005 1653 CDS 100% 13.200 18.480 N Smpd4 n/a
3 TRCN0000124165 GCCTGAAAGCTGACTCTATAA pLKO.1 170 CDS 100% 13.200 18.480 N Smpd4 n/a
4 TRCN0000331603 GCCTGAAAGCTGACTCTATAA pLKO_005 170 CDS 100% 13.200 18.480 N Smpd4 n/a
5 TRCN0000245620 CCTGAAAGCTGACTCTATAAA pLKO_005 171 CDS 100% 15.000 10.500 N SMPD4 n/a
6 TRCN0000245619 GGAGTACCTGCGCCAGATATT pLKO_005 1893 CDS 100% 13.200 9.240 N SMPD4 n/a
7 TRCN0000124168 CCTCAATCCATTTGAATACTA pLKO.1 576 CDS 100% 5.625 3.938 N Smpd4 n/a
8 TRCN0000124164 GCAGTGGTGGAGTTATTCAAA pLKO.1 2608 3UTR 100% 5.625 3.938 N Smpd4 n/a
9 TRCN0000302442 GCAGTGGTGGAGTTATTCAAA pLKO_005 2608 3UTR 100% 5.625 3.938 N Smpd4 n/a
10 TRCN0000124167 CCAATGTCTATGACCCTCCAT pLKO.1 634 CDS 100% 2.640 1.848 N Smpd4 n/a
11 TRCN0000302505 CCAATGTCTATGACCCTCCAT pLKO_005 634 CDS 100% 2.640 1.848 N Smpd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12238 pDONR223 100% 72% 75.9% None (many diffs) n/a
2 ccsbBroad304_12238 pLX_304 0% 72% 75.9% V5 (many diffs) n/a
3 TRCN0000477592 CCTTTCAAACCCGATGTTAGGCCA pLX_317 5% 72% 75.9% V5 (many diffs) n/a
Download CSV