Transcript: Human NM_001164692.2

Homo sapiens leukotriene B4 receptor 2 (LTB4R2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
LTB4R2 (56413)
Length:
1560
CDS:
172..1248

Additional Resources:

NCBI RefSeq record:
NM_001164692.2
NBCI Gene record:
LTB4R2 (56413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368542 GGATCTGGCTGGGTAGGATTA pLKO_005 1357 3UTR 100% 10.800 7.560 N LTB4R2 n/a
2 TRCN0000357602 GTCAGTGTTCTGGGACATTTG pLKO_005 1312 3UTR 100% 10.800 7.560 N LTB4R2 n/a
3 TRCN0000357530 CCTTGGCCTTCTTCAGTTCTA pLKO_005 995 CDS 100% 4.950 3.465 N LTB4R2 n/a
4 TRCN0000357532 GACCGCTTTCGTGCTTCCTTT pLKO_005 732 CDS 100% 4.950 3.465 N LTB4R2 n/a
5 TRCN0000011727 CTTCTTCAGTTCTAGCGTCAA pLKO.1 1002 CDS 100% 4.050 2.835 N LTB4R2 n/a
6 TRCN0000011728 CGTGCTTCCTTTCGGGCTGAT pLKO.1 741 CDS 100% 1.350 0.945 N LTB4R2 n/a
7 TRCN0000011731 TGTGGCGCCTTCCACCCACCT pLKO.1 137 5UTR 100% 0.000 0.000 N LTB4R2 n/a
8 TRCN0000357531 TTTGACAGCAGACCCTACAAC pLKO_005 1244 CDS 100% 4.950 2.475 Y LTB4R2 n/a
9 TRCN0000011729 CCGTTTCCTCACGCGGCTCTT pLKO.1 1074 CDS 100% 0.000 0.000 Y LTB4R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492059 ATATATCGGGACGATGGCGCCTAT pLX_317 29.4% 92% 92% V5 0_1ins93 n/a
2 TRCN0000488140 TTTCTCTGCTGCAAACACCTTCAC pLX_317 21.4% 92% 92% V5 (not translated due to prior stop codon) 0_1ins93 n/a
Download CSV