Transcript: Human NM_001165257.1

Homo sapiens secretogranin III (SCG3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SCG3 (29106)
Length:
3313
CDS:
1047..1757

Additional Resources:

NCBI RefSeq record:
NM_001165257.1
NBCI Gene record:
SCG3 (29106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165257.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373399 ACCTTGCAGAGCGTGTCTATT pLKO_005 2144 3UTR 100% 13.200 18.480 N SCG3 n/a
2 TRCN0000373470 ACTACTTAATCTCGGCCTTAT pLKO_005 872 5UTR 100% 10.800 15.120 N SCG3 n/a
3 TRCN0000083633 CCAGGCAGTAAGGTAGAAATA pLKO.1 2553 3UTR 100% 13.200 9.240 N SCG3 n/a
4 TRCN0000373468 TAAGAGTGGATTGGATCATAA pLKO_005 719 5UTR 100% 13.200 9.240 N SCG3 n/a
5 TRCN0000083636 CCGTGTTTGACAAGATTGTTT pLKO.1 847 5UTR 100% 5.625 3.938 N SCG3 n/a
6 TRCN0000083637 CCTTTCAAAGATGAGAGACTT pLKO.1 1646 CDS 100% 4.950 3.465 N SCG3 n/a
7 TRCN0000083635 GCCAACAATTATGAGGAGGAT pLKO.1 963 5UTR 100% 2.640 1.848 N SCG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165257.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08114 pDONR223 100% 50.4% 50.4% None 0_1ins696 n/a
2 ccsbBroad304_08114 pLX_304 0% 50.4% 50.4% V5 0_1ins696 n/a
3 TRCN0000473959 TCGTACCCCAACGACGCCCACATG pLX_317 39.8% 50.4% 50.4% V5 0_1ins696 n/a
Download CSV