Transcript: Human NM_001166050.2

Homo sapiens amyloid beta precursor protein binding family B member 2 (APBB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
APBB2 (323)
Length:
8896
CDS:
555..2831

Additional Resources:

NCBI RefSeq record:
NM_001166050.2
NBCI Gene record:
APBB2 (323)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414943 ACCCTACGCTATGCATCTTTG pLKO_005 1716 CDS 100% 10.800 15.120 N APBB2 n/a
2 TRCN0000016544 GCCGCCTGCATGTTACGATAT pLKO.1 2652 CDS 100% 10.800 15.120 N APBB2 n/a
3 TRCN0000419553 GAACTAAGAGCTTCCTAAATT pLKO_005 1024 CDS 100% 15.000 12.000 N APBB2 n/a
4 TRCN0000418128 GACATTGCCGGGACCTATTAT pLKO_005 1455 CDS 100% 15.000 12.000 N APBB2 n/a
5 TRCN0000328167 TGACATTGCCGGGACCTATTA pLKO_005 1454 CDS 100% 13.200 10.560 N Apbb2 n/a
6 TRCN0000016546 GCTTATGTAGCAAGAGATAAA pLKO.1 2088 CDS 100% 13.200 9.240 N APBB2 n/a
7 TRCN0000418064 CTGAGAAGTTAGAGGGTAAAG pLKO_005 949 CDS 100% 10.800 7.560 N APBB2 n/a
8 TRCN0000442389 GAAACGCCCTGTCACCGAAAT pLKO_005 2804 CDS 100% 10.800 7.560 N APBB2 n/a
9 TRCN0000438615 TCCGAGACACAGTCGGGATTT pLKO_005 1924 CDS 100% 10.800 7.560 N APBB2 n/a
10 TRCN0000016547 CGATATCAGAAGTGCTTGGTA pLKO.1 2667 CDS 100% 3.000 2.100 N APBB2 n/a
11 TRCN0000016543 CAGGCAACTTTCCTACTGCAA pLKO.1 1895 CDS 100% 2.640 1.848 N APBB2 n/a
12 TRCN0000016545 GAAGAGGAAGTCTTAGTGGAA pLKO.1 2487 CDS 100% 2.640 1.848 N APBB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166050.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10680 pDONR223 100% 43.4% 43.4% None 1_1284del;1728_1730delAGT n/a
2 ccsbBroad304_10680 pLX_304 0% 43.4% 43.4% V5 1_1284del;1728_1730delAGT n/a
3 TRCN0000467211 TCGACAATGATCTCATCATGGCAT pLX_317 30.8% 43.4% 43.4% V5 1_1284del;1728_1730delAGT n/a
Download CSV