Transcript: Human NM_001166056.2

Homo sapiens peptidase D (PEPD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PEPD (5184)
Length:
1784
CDS:
32..1390

Additional Resources:

NCBI RefSeq record:
NM_001166056.2
NBCI Gene record:
PEPD (5184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437484 TCGACATGGGCGGTGAGTATT pLKO_005 732 CDS 100% 13.200 18.480 N PEPD n/a
2 TRCN0000434117 GCAAGTTCGAAGTCAACAATA pLKO_005 531 CDS 100% 13.200 9.240 N PEPD n/a
3 TRCN0000073918 GCTTATTAAATGAGCGACTTA pLKO.1 1609 3UTR 100% 4.950 3.465 N PEPD n/a
4 TRCN0000222538 GCAGACCAGAAGGCCGTCTAT pLKO.1 806 CDS 100% 1.650 1.155 N PEPD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01172 pDONR223 100% 91.6% 91.6% None 547_548ins123 n/a
2 ccsbBroad304_01172 pLX_304 0% 91.6% 91.6% V5 547_548ins123 n/a
3 TRCN0000467094 CAAGTGTCCTCTAGTGCTCAAACC pLX_317 27.6% 91.6% 91.6% V5 547_548ins123 n/a
4 ccsbBroadEn_10441 pDONR223 100% 91.4% None (many diffs) n/a
5 ccsbBroad304_10441 pLX_304 0% 91.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000479025 TCCTCACTCTGAATTCCGACCTCG pLX_317 25.7% 91.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV