Transcript: Human NM_001166107.1

Homo sapiens 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
HMGCS2 (3158)
Length:
2351
CDS:
89..1489

Additional Resources:

NCBI RefSeq record:
NM_001166107.1
NBCI Gene record:
HMGCS2 (3158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429288 GGATTCAGGCAATACTGATAT pLKO_005 538 CDS 100% 13.200 10.560 N HMGCS2 n/a
2 TRCN0000419037 CCCTTCACCCTTGACGATTTA pLKO_005 827 CDS 100% 13.200 9.240 N HMGCS2 n/a
3 TRCN0000045858 CCTGAGGAGTTCACAGAAATA pLKO.1 1331 CDS 100% 13.200 9.240 N HMGCS2 n/a
4 TRCN0000045862 GAGGGCATAGATACCACCAAT pLKO.1 560 CDS 100% 4.950 3.465 N HMGCS2 n/a
5 TRCN0000045860 CCTTCTCTTATGGCTCTGGTT pLKO.1 1188 CDS 100% 2.640 1.848 N HMGCS2 n/a
6 TRCN0000045861 GAGAAGTATAACAATGTGGAA pLKO.1 308 CDS 100% 2.640 1.848 N HMGCS2 n/a
7 TRCN0000045859 CCCTTGACGATTTACAGTATA pLKO.1 834 CDS 100% 13.200 18.480 N HMGCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00756 pDONR223 100% 91.7% 91.7% None 558_559ins126 n/a
2 ccsbBroad304_00756 pLX_304 0% 91.7% 91.7% V5 558_559ins126 n/a
3 TRCN0000475671 TGGTATTTCCTAATAACTATATAT pLX_317 8.2% 91.7% 91.7% V5 558_559ins126 n/a
Download CSV