Transcript: Human NM_001166221.1

Homo sapiens UTP14A small subunit processome component (UTP14A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
UTP14A (10813)
Length:
2421
CDS:
91..2250

Additional Resources:

NCBI RefSeq record:
NM_001166221.1
NBCI Gene record:
UTP14A (10813)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330887 GTCTGAATTGAGAGTACTATC pLKO_005 1305 CDS 100% 10.800 15.120 N UTP14A n/a
2 TRCN0000330886 CAAAGAAGACAGTGGAGTTAC pLKO_005 425 CDS 100% 10.800 7.560 N UTP14A n/a
3 TRCN0000353705 GAACCTCCTAACCACACAATC pLKO_005 1620 CDS 100% 10.800 7.560 N UTP14A n/a
4 TRCN0000330960 TGAATGCAGATGGGCCGAATC pLKO_005 1034 CDS 100% 6.000 4.200 N UTP14A n/a
5 TRCN0000143787 GCAGGAACAGTTGTCTAAGAA pLKO.1 903 CDS 100% 5.625 3.938 N UTP14A n/a
6 TRCN0000330888 ATCCAGCTGCAGCACTAGAAG pLKO_005 758 CDS 100% 4.950 3.465 N UTP14A n/a
7 TRCN0000142763 CAGCTGAAGAAATGCTCTGTA pLKO.1 2224 CDS 100% 4.950 3.465 N UTP14A n/a
8 TRCN0000143521 GAAGTGCAGATGAATGCAGAT pLKO.1 1024 CDS 100% 4.050 2.835 N UTP14A n/a
9 TRCN0000143036 CCATGGAGTTTCTGAAAGTGA pLKO.1 1137 CDS 100% 3.000 2.100 N UTP14A n/a
10 TRCN0000179488 GATGGAAAGAATAGGCGGAAA pLKO.1 250 CDS 100% 4.050 2.025 Y ALG11 n/a
11 TRCN0000138963 CGTGAAGAAAGGAAAGGCCAA pLKO.1 699 CDS 100% 2.160 1.080 Y UTP14A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02534 pDONR223 100% 93.2% 93.2% None 380_381ins156 n/a
2 ccsbBroad304_02534 pLX_304 0% 93.2% 93.2% V5 380_381ins156 n/a
3 TRCN0000465578 TGCATGACACCAAGGCCATCATCG pLX_317 15.3% 93.2% 93.2% V5 380_381ins156 n/a
4 ccsbBroadEn_07476 pDONR223 100% 87.4% 83.8% None (many diffs) n/a
5 ccsbBroad304_07476 pLX_304 0% 87.4% 83.8% V5 (many diffs) n/a
6 TRCN0000470431 CGCCTCAAGTTATAAGACGTAATG pLX_317 14.6% 87.4% 83.8% V5 (many diffs) n/a
Download CSV