Transcript: Human NM_001166254.3

Homo sapiens thromboxane A synthase 1 (TBXAS1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
TBXAS1 (6916)
Length:
2118
CDS:
496..1896

Additional Resources:

NCBI RefSeq record:
NM_001166254.3
NBCI Gene record:
TBXAS1 (6916)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435686 GTCGGATGTTTATTGTTATTT pLKO_005 545 CDS 100% 15.000 21.000 N TBXAS1 n/a
2 TRCN0000415143 CCTCATCGCTGGCTATGAAAT pLKO_005 1308 CDS 100% 13.200 18.480 N TBXAS1 n/a
3 TRCN0000045328 CCCAATAAGAACCGAGACGAA pLKO.1 1024 CDS 100% 2.640 3.696 N TBXAS1 n/a
4 TRCN0000045332 CGAGACGAACTGAATGGCTTT pLKO.1 1036 CDS 100% 4.050 3.240 N TBXAS1 n/a
5 TRCN0000429032 TTATCATTTCCATCCATAATG pLKO_005 982 CDS 100% 13.200 9.240 N TBXAS1 n/a
6 TRCN0000045330 CGCTGCAGCTAGAATCCAAAT pLKO.1 1826 CDS 100% 10.800 7.560 N TBXAS1 n/a
7 TRCN0000045331 GTTGAGAACTTCAGTAACTTT pLKO.1 595 CDS 100% 5.625 3.938 N TBXAS1 n/a
8 TRCN0000045329 CCAGAGGTGCTACTGCAATTA pLKO.1 828 CDS 100% 13.200 7.920 N TBXAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01649 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01649 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478515 TCCGACATCCTCCTGTGCTGAACA pLX_317 25.8% 100% 100% V5 n/a
Download CSV