Construct: ORF TRCN0000478515
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014396.1_s317c1
- Derived from:
- ccsbBroadEn_01649
- DNA Barcode:
- TCCGACATCCTCCTGTGCTGAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TBXAS1 (6916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478515
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_001166254.3 | 100% | 100% | |
| 2 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | XM_024446901.1 | 96.1% | 96.1% | 0_1ins54 |
| 3 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_001314028.3 | 90.6% | 88.5% | 1_115del;151_179del |
| 4 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_001061.7 | 87.4% | 87.4% | 1_201del |
| 5 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_001130966.4 | 87.4% | 87.4% | 1_201del |
| 6 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_001366537.2 | 85.9% | 89.3% | 1_115del;149_150ins97 |
| 7 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_001166253.3 | 80.4% | 80.4% | 1_201del;451_588del |
| 8 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | NM_030984.5 | 73.4% | 72.7% | (many diffs) |
| 9 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | XM_011516544.3 | 73.4% | 72.5% | (many diffs) |
| 10 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | XM_017012571.2 | 62.6% | 58.6% | (many diffs) |
| 11 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | XM_017012572.2 | 62.1% | 57.5% | (many diffs) |
| 12 | human | 6916 | TBXAS1 | thromboxane A synthase 1 | XM_017012570.2 | 61.6% | 56.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1464
- ORF length:
- 1398
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gctcagaaag ctgtatggac ctctgtgtgg gtactatctt ggtcgtcgga 121 tgtttattgt tatttctgag ccagacatga tcaagcaggt gttggttgag aacttcagta 181 actttaccaa cagaatggcg tcgggtttgg agttcaagtc ggtagccgac agcgttctgt 241 ttttacgtga caaaagatgg gaagaggtca gaggtgccct gatgtctgct ttcagtcctg 301 aaaagctgaa cgagatggtt cccctcatca gccaagcctg cgaccttctc ctggctcatt 361 taaaacgcta tgcggaatct ggggacgcat ttgacatcca gaggtgctac tgcaattaca 421 ccacagatgt ggttgccagc gtcgcctttg gcaccccggt ggactcctgg caggcccctg 481 aggatccctt tgtgaaacac tgcaagcgtt tcttcgaatt ctgcatcccc agacctatcc 541 tggttttact cttatcattt ccatccataa tggtcccact ggcccggatt ttgcccaata 601 agaaccgaga cgaactgaat ggctttttta acaaactcat taggaatgtg attgccttgc 661 gggaccagca agctgccgaa gagaggcgga gagacttcct ccaaatggtc ctggatgccc 721 gacattctgc aagtcccatg ggcgtgcaag actttgacat cgtcagagac gttttctcct 781 ctactgggtg caagccgaac ccttcccggc aacaccagcc cagccctatg gccaggcctt 841 tgactgtgga tgagattgtg ggccaggcct tcatcttcct catcgctggc tatgaaatca 901 tcaccaacac actttctttt gccacctacc tactggccac caaccctgac tgccaagaga 961 agcttctgag agaggtagac gtttttaagg agaaacacat ggcccctgag ttctgcagcc 1021 tcgaggaagg cctgccctat ctggacatgg tgattgcaga gacgctgagg atgtacccgc 1081 cagctttcag attcacacgg gaggcagcTC AGGACTGCGA GGTGCTGGGG CAGCGCATCC 1141 CCGCAGGCGC TGTGCTAGAG ATGGCCGTGG GTGCCCTGCA CCATGACCCT GAGCACTGGC 1201 CAAGCCCGGA GACCTTCAAC CCTGAAAGGT TCACGGCTGA GGCCCGGCAG CAGCACCGGC 1261 CCTTCACGTA CCTGCCCTTC GGGGCCGGCC CACGGAGCTG CCTCGGGGTG CGTCTAGGGC 1321 TGCTTGAGGT CAAGTTGACA CTGCTCCACG TGCTGCACAA GTTCCGGTTC CAAGCCTGCC 1381 CTGAGACCCA GGTACCGCTG CAGCTAGAAT CCAAATCTGC CCTAGGTCCA AAAAATGGTG 1441 TCTATATCAA GATCGTATCC CGCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1501 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1561 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CCGACATCCT 1621 CCTGTGCTGA ACAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1681 att